Labshake search
Citations for Illumina :
501 - 550 of 2584 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina). Sequencing reads were aligned to the reference genomes (C ...
-
bioRxiv - Bioengineering 2019Quote: ... sequencing adaptors and unique dual barcodes combinations were attached to each library PCR amplicons using the Nextera XT Index Kit primers (index 1 N7XX and index 2 S5XX, Illumina, CA), and the amplicon size and concentration were confirmed using a Bioanalyzer (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Samples were sequenced on an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA) to a depth of approximately 100,000 reads per cell ...
-
bioRxiv - Immunology 2021Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Developmental Biology 2021Quote: ... 10%(v/v) N,N-dimethyl formamide) and 1 μl of Tagment DNA Enzyme from Nextera Sample Preparation Kit (Illumina) were added to the DNA-beads complex and incubated for 70 sec at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... and marker-wise (HWE P value > 1 × 10−6, call rate > 95%, and for the GSA array additionally by Illumina GenomeStudio GenTrain score > 0.6 ...
-
bioRxiv - Systems Biology 2021Quote: ... GBC sequencing libraries were spiked into transcriptome libraries at 1:10 and sequenced on the NextSeq or MiSeq platform (Illumina). Transcriptome libraries were sequenced separately using a NovaSeq5000 S2 300-cycle kit.
-
bioRxiv - Cancer Biology 2022Quote: ... Gene expression libraries and barcode enrichment libraries were pooled in an approximately 10:1 molar ratio and libraries were sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Paired-end sequencing was performed for all libraries (read 1:28 bp, index read: 10 bp, read2: 82 bp) on a NovaSeq 6000 (Illumina) using NovaSeq SP Reagent Kits (100 cycles).
-
bioRxiv - Microbiology 2019Quote: ... and 2×300bp PE Miseq (Illumina) sequencing at UBC Pharmaceutical Sciences Sequencing Centre (Vancouver ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Cancer Biology 2022Quote: ... but from purified CLL cells (Miltenyi B-CLL Isolation kit) and sequenced on an Illumina HiSeq 4000 (Illumina, Hayward, CA, USA). miRNA data in the form of fastq were quality checked using FastQC ...
-
bioRxiv - Genomics 2021Quote: Custom RNA capture-based libraries were prepared starting from 8.5 μL eluate for biofluid samples and 100 ng RNA for FFPE and MAQCA/B using the TruSeq RNA Exome Library Prep Kit (Illumina, USA). Library preparation happened according to the manufacturer’s protocol with some minor modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... libraries for sequencing were prepared from using the TrueSeq RNA Sample Prep Kit v2-Set B (Illumina, San Diego, CA, US) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... sequence libraries were prepared for each sample using TruSeq Stranded mRNA Library Prep/TruSeq RNA Single Indexes Set A & Set B (Illumina, Inc.). For sequencing ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2020Quote: ... after which the samples were pooled into one library and subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle kits (Illumina) at a concentration of 12pM.
-
bioRxiv - Developmental Biology 2021Quote: ... 75-bp single-end sequencing was performed on 12 multiplexed libraries pooled together in one flow cell using a NextSeq 500 high output sequencer (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Equal amount of each RNA-seq library was mixed for sequencing in one lane of Illumnia HiSeq3000 in paired-end 150 base mode (Illumina).
-
bioRxiv - Genetics 2021Quote: DNA samples have been obtained from 12,500 individuals and genotyped on one of two DNA microarrays (Affymetrix GeneChip 6.0 or Illumina HumanOmniExpressExome chips). After stringent quality control ...
-
bioRxiv - Neuroscience 2021Quote: ... Library pool was quantified on Bioanalyzer and with qPCR and sequenced using one NextSeq 500/550 High Output Kit v2.5 (Illumina, 20024907) on Illumina NextSeq500 using these parameters ...
-
bioRxiv - Genomics 2020Quote: ... One of the DNA preps inferred to have HMW DNA was used to prepare a linked reads Chromium library (10x genomics) and was sequenced on one lane of HiSeqX (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... #PN-120237) with 18 cDNA pre-amplification cycles and sequencing on one high-output lane of the NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... these had been selected using BARCOSEL26 to allow pooling and sequencing of all samples in one pool run on three separate runs on a MiSeq (Illumina; v3 600 cycle kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... at least one microgram of each DNA or RNA (depleted of ribosomal RNA using Illumina Ribo-Zero rRNA Removal Kit) sample was sequenced commercially using the Illumina HiSeq2500 platform with 150 or 250-base paired-end libraries (Novogene Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The final pool was loaded in one lane of an S2 flow cell using the NovaSeq XP protocol (Illumina Inc.) (Figure S3 ...
-
bioRxiv - Bioengineering 2022Quote: ... Barcoded RNA-seq libraries were sequenced using a NovaSeq 6000 on one SP lane with single-reads 100 nt in length (Illumina). FastQ read files were generated and demultiplexed using the bcl2fastq v2.20 Conversion Software (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... One and a half picomoles of pooled libraries were sequenced in the 75bp single-end configuration on a NextSeeq500 (Illumina) using a NextSeq 500/550 High Output Kit ...
-
bioRxiv - Clinical Trials 2019Quote: ... Three hundred eighty-four purified samples were pooled into one library and then subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle kits (Illumina) at a concentration of 12 pM.
-
bioRxiv - Immunology 2020Quote: ... 384 purified samples were pooled into one library and then subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle kits (Illumina) at a concentration of 12 pM.
-
bioRxiv - Molecular Biology 2019Quote: ... DNA isolated from subway air samples were subjected to SMS (150 bp paired-end) multiplexed on one lane (∼80-130M paired-end reads) on a HiSeq 3000 (Illumina). Library preparation was done with the ThruPLEX DNA-Seq kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA libraries were prepared as outlined by the Single Cell 3′ Reagent kit v3 user guide and each of the three resulting libraries were sequenced on one lane each of a HiSeq 2500 (Illumina) in rapid mode.
-
bioRxiv - Genomics 2020Quote: ... DNA pools and from one single individual of each sex were constructed using the Genomic DNA Sample Preparation Kit (Illumina) according to manufacturer’s instructions and sequenced on the Illumina HiSeq2000 platform (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... The two enriched libraries from direct flow cytometric cell sorting were combined into one library pool and sequenced on a NovaSeq sequencer (Illumina) with a NovaSeq 6000 S1 Reagent Kit (300 cycles ...
-
bioRxiv - Immunology 2020Quote: ... The six enriched libraries from bulk expansion were combined into one library pool and sequenced on a NovaSeq sequencer with a NovaSeq 6000 S4 Reagent Kit (300 cycles (Illumina). All enriched V(D)J libraries were targeted for sequencing depth of at least 5,000 raw read pairs per cell ...
-
bioRxiv - Immunology 2020Quote: ... One ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit - Illumina) in 8 μl reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... All RNA samples were shipped on dry ice to the DNA Technologies Core at the University of California Davis for library construction with poly-A enrichment and sequencing on one lane of the NovaSeq 6000 platform (Illumina) with S4 type flow cell (150 bp PE).
-
bioRxiv - Molecular Biology 2022Quote: The RNA from the lysates and elutions of three HOW(S)-HA pull-downs and one nanos-GAL4 parental control pull-down was prepared using the Ribo-Zero rRNA Removal Kit (Illumina) followed by the TruSeq Stranded Total RNA Library Prep (Illumina) ...
-
bioRxiv - Pathology 2023Quote: ... One hundred nanograms of DNA obtained from tails were used for library preparation with a TruSeq DNA Nano kit (Illumina). Libraries were sequenced on the NovaSeq 6000 platform (2 x 150 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used to prepare a whole-transcriptome sequencing library and sequenced on one lane of a NovaSeq 6000 SP (Illumina) machine.
-
bioRxiv - Genetics 2023Quote: ... and the pool was sequenced on one lane of the Illumina HiSeq 4000 sequencer with a 75 bp Paired-End SBS chemistry (Illumina).