Labshake search
Citations for Illumina :
5601 - 5650 of 9484 citations for Cow Fibrinogen Like Protein 1 FGL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Genomics 2019Quote: ... and biotinylated fragments were purified using M280 Streptavidin Dynabeads (Thermo) and reagents from the Nextera_Mate_Pair Sample preparation kit (Illumina). Purified biotiny-lated DNA was then processed using the TrueSeq nano DNA kit (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosome footprint libraries and companion RNAseq libraries were then produced using the Truseq Ribo Profiling Kit from Illumina according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA was depleted from the sample using the Gram-negative bacteria Ribo-Zero rRNA Removal Kit (Illumina-Epicentre). RNA-seq libraries were prepared with an Illumina TruSeq stranded RNA kit according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: RNA sequencing libraries were prepared using the Illumina TruSeq stranded RNA Library Prep Kit (Illumina # RS-122-2101) according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Molecular Biology 2019Quote: RNA sequencing libraries were prepared using the Illumina TruSeq stranded RNA Library Prep Kit (Illumina # RS-122-2101) according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2019Quote: Metagenomic libraries were prepared for sequencing and indexed using the Nextera XT DNA Library Preparation Kit (Illumina, USA), following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Sequencing libraries were generated using TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) following the manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Molecular Biology 2019Quote: ChIP DNA was subjected to library preparation using TruSeq ChIP sample preparation kit from Illumina (IP-202-1012). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polyadenylated RNAs were extracted and sequencing libraries were prepared using the TruSeq stranded mRNA Library Prep kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The cDNA (50 ng) was fragmented and amplified for sequencing with the Nextera DNA sample prep kit (Illumina) using custom primers that enabled the cDNA sequence from Read1 (Supplementary Table S3) ...
-
bioRxiv - Zoology 2019Quote: ... The sequencing step was performed with a Illumina MiSeq sequencer using a SBS MiSeq Reagent Kit v2 (Illumina). PhiX Control library (v2 ...
-
bioRxiv - Immunology 2019Quote: ... Illumina-ready libraries were prepared from cDNA using the Illumina Nextera XT DNA Library Prep Kit (Illumina, SD). Next generation sequencing (NGS ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA libraries for paired-end sequencing were prepared using the TruSeq Stranded mRNA library preparation kit (Illumina, USA). RNA sequencing was performed at Illumina HiSeq platform (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were sequenced on an Illumina MiSeq with a v3 600-cycle reagent kit (Illumina, San Diego, CA) using custom read 1 primer LibSeq_R1Seq_Rev and custom read 2 primer LibSeq_R2Seq_For loaded into the cartridges read 1 and read 2 primer wells ...
-
bioRxiv - Molecular Biology 2019Quote: ... Australia) for whole transcriptome library preparation using the TruSeq Stranded Total RNA Library Prep Kit (Illumina, CA, USA) and ribosomal RNA depletion with the Ribo-Zero-Gold kit (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Whole-genome sequencing was performed using the Nextera XT DNA Sample Preparation kit (Illumina, San Diego, CA, USA) and the Illumina MiSeq platform ...
-
bioRxiv - Cancer Biology 2020Quote: ... Next-generation sequencing libraries were prepared from 1ng dsDNA using the Nextera XT DNA library preparation kit (Illumina) and indexed using the Nextera XT index Kit (Illumina) ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were converted into cDNA libraries using the Illumina TruSeq Stranded mRNA sample preparation kit (Illumina Cat. #20020595) and were sequenced using HISeq-Sequencing-2×50bp-PE ...
-
bioRxiv - Developmental Biology 2020Quote: Low-pass whole genome sequencing (depth of sequencing < 0.1x) libraries were prepared using the VeriSeq PGS Kit (Illumina) or the NEB Ultra II FS Kit and sequenced with the MiSeq platform as previously described (17 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exome capture was carried out using manufacturer protocols using the TruSeq Exome Enrichment Kit (Illumina, San Diego, CA) and sequenced on the HiSeq 2000 Sequencing System (Illumina) ...
-
bioRxiv - Genomics 2019Quote: ... and DNA End-repair Kit (ER81050; Epcentre) according to the user’s manual (Epcentre) and sample preparation guide (Illumina).
-
bioRxiv - Genetics 2020Quote: ... was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads) (Illumina).
-
bioRxiv - Immunology 2019Quote: Sequencing libraries were constructed from total RNA using TruSeq RNA Sample Preparation Kits v2 (Illumina, San Diego, CA). Libraries were clustered onto a flowcell using a cBOT amplification system with a HiSeq SR v3 Cluster Kit (Illumina) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... was used for library preparation using the TruSeq ChIP Sample Prep Kit (Illumina, Cat. No. IP-202-1012). One hundred base pair single-end read sequencing reactions were performed on an Illumina Hi-Seq 2500 sequencer at by the Genomics Platform of the University of Geneva.
-
bioRxiv - Genetics 2019Quote: ... Sequencing libraries were created with the Nextera XT kit (Illumina Cat. FC-131-1024 and FC-131-2001), using 150 pg of total cDNA as input for tagmentation ...
-
bioRxiv - Genetics 2021Quote: ... and sequencing libraries were prepared using the TruSeq Stranded mRNA Sample Prep Kit with oligo(dT) selection (Illumina). 125-cycle paired-end sequencing was performed on an Illumina HiSeq 2500 instrument (12 libraries/lane).
-
bioRxiv - Systems Biology 2021Quote: ... We then loaded the cDNA library onto an Illumina MiSeq system using the MiSeq Reagent Kit v3 (Illumina). We analyzed the resulting RNA-seq data as previously described in Trapnell et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA-seq transcriptome library was prepared following TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA) using 1μg of total RNA ...
-
bioRxiv - Microbiology 2021Quote: ... University of Glasgow where libraries were prepared with a TruSeq® Nano DNA LT Sample Prep Kit (Illumina), quality controlled on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting RNA was then used for library preparation using the TruSeq small RNA Sample Prep Kit (Illumina) according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Strand-specific RNA-seq libraries were prepared from each RNA sample using the TruSeq RNA kit from Illumina according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Then strand-specific libraries were prepared using the TruSeq® Stranded Total RNA Sample Preparation kit (Illumina, USA). TruSeq PE (paired-end ...
-
bioRxiv - Microbiology 2020Quote: ... library preparation was carried out using an adapted tagmentation and Nextera kit from Illumina (Baym et al. 2015). Raw reads were deposited to NCBI SRA under BioProject PRJNA646688.
-
bioRxiv - Microbiology 2021Quote: ... The ribosomal RNA from eukaryotes and bacteria were removed using the Ribo-Zero Plus rRNA Depletion Kit (Illumina), and RNAseq libraries were constructed with either the NEB directional RNA preparation kit (P ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Plant Biology 2020Quote: ... and ∼25 ng of sRNA was used for library construction with the TruSeq Small RNA Prep Kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: Isolates were prepared for sequencing using the TrueSeq Nano DNA HT Library Preparation kit (Illumina, San Diego, USA). The libraries were sent to the Functional Genomics Centre Zurich (ETH Zurich and University of Zurich ...
-
bioRxiv - Physiology 2020Quote: Sequencing libraries (n=167) were prepared with the TruSeq Stranded mRNA HS kit (Illumina, San Diego, California, USA). The 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tagmentation and library preparation was performed using the Nextera XT DNA Library Preparation Kit (Illumina, Cat# FC-131) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... fragmented to 260 bases and libraries were built using the TruSeq stranded mRNA kit (Illumina®, California, U.S.A.) with an Applied BioSystem 2720 Thermal Cycler and barcoded adaptors ...
-
bioRxiv - Genomics 2021Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Immunology 2021Quote: ... All SMART-Seq2 Libraries were sequenced using a NextSeq 500/550 High Output v2 kit 75 cycles (Illumina) on a Nextseq 500 (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Samples were barcoded and used for 50bp/50bp paired end runs with the TruSeq SBS Kit v4 (Illumina) on a HiSeq 2500 sequencer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing libraries prepared with the Illumina TruSeq DNA Sample Preparation Kit were 10-plexed (Illumina adapters Set A) per flow-cell lane and sequenced on an Illumina HiSEquation 2000 instrument to obtain at least 10-fold genome coverage ...
-
bioRxiv - Microbiology 2019Quote: ... Amplified RNA was used to construct sequencing libraries using the TruSeq Stranded RNA LT Sample Prep Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... A paired-end library was prepared using Nextera XT DNA library preparation kit (Illumina, San Diego, CA, USA). All the libraries were multiplexed on one MiSeq run ...
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.