Labshake search
Citations for Illumina :
5851 - 5900 of 9484 citations for Cow Fibrinogen Like Protein 1 FGL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... libraries were produced from 50 ng of DNA with the Nextera XT DNA Sample Preparation Kit (Illumina, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Strand-specific sequencing libraries were generated using TruSeq stranded total RNA library preparation kit (Illumina Inc. Cat # 20020596) and sequenced as 75bp paired-end reads on an Illumina instrument.
-
bioRxiv - Cancer Biology 2022Quote: ... and transcriptome capture based libraries with the TruSeq RNA Access Library Prep Kit (Illumina, cat# RS-301-2001). Recommended amounts of starting material were as follows ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for ATAC samples were prepared using the Nextera DNA library preparation kit (Illumina, #FC-121-1030) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: The dRNA-seq libraries were constructed using Illumina Small RNA Sample Prep Kit (Illumina, San Diego, CA, USA) following the vendor’s instruction with some modifications ...
-
bioRxiv - Microbiology 2022Quote: ... Pan-viral target hybridization enrichment sequencing was performed by using RNA Prep with Enrichment (L) Tagmentation Kit (Illumina) and Comprehensive Viral Research Panel (Twist Biosciences).
-
bioRxiv - Microbiology 2023Quote: ... and the library was sequenced on an Illumina MiSeq desktop sequencer using the MiSeq Reagent Kit V3 (Illumina) for 2x 300 bp paired-end sequencing ...
-
bioRxiv - Evolutionary Biology 2023Quote: Sequencing libraries were prepared using the Tagment DNA Enzyme and Buffer Large Kit (Illumina, San Diego CA, USA), the KAPA HiFi HotStart ReadyMix 2X (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (1ug) was processed to first-stranded cDNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina), following the manufacturer’s instructions for the low-throughput protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Complementary DNA library construction was performed using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Strand-specific mRNA libraries were prepared from total RNA using TruSeq Stranded mRNA Sample Prep Kit LS (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... the NextSeq 550 platform and the NextSeq 500/550 Mid-Output kit v2.5 (Illumina Inc. San Diego, USA) were used ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed on Illumina NextSeq with NextSeq® 500/550 High Output Kit v2.5 (300 cycles; Illumina) in pair-end [PE] read mode ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing libraries were prepared using the Rapid Directional RNA-Seq Kit (NEXTflex) and sequenced on a NextSeq500 (Illumina) to produce 75 base long reads (Utrecht DNA Sequencing Facility) ...
-
bioRxiv - Microbiology 2023Quote: ... The transcriptome libraries were constructed by using the TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA) and was sequenced using the Illumina NovaSeq 6000 platform at Shanghai Majorbio Bio-pharm Technology Co. ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was prepared for sequencing on the Illumina MiSeq platform using the Nextera XT DNA preparation kit (Illumina) with ×300 bp paired end chemistry and with a targeted sequencing depth of >50× ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic library construction was performed using the Nextera DNA Flex Library Prep kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Directional libraries were prepared using the TruSeq Stranded mRNA Sample preparation kit (20020595) following the manufacturer’s instructions (Illumina). 51-bp Single Read sequences were generated on the Hiseq2000 sequencer according to manufacturer’s instructions (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using 100–500 ng total RNA with TruSeq Stranded RNA Sample Preparation Kit (Illumina, v2) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: Sequencing libraries were prepared by tagmenting 10 ng WTA DNA with Nextera XT kit (Illumina #FC-131-1024). Indexing PCR was primed with a nextera i7 index primer (e.g ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA libraries were prepared with poly-A selection using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) and paired-end 75 bp sequencing to a depth of ∼50 million reads per sample was performed using the Illumina HiSeq 2500 system at the UCLA Neuroscience Genomics Core.
-
bioRxiv - Microbiology 2023Quote: ... The amplified barcodes were sequenced using a 75-cycle MiniSeq High Output Reagent Kit (Illumina, FC-420-1001) on an Illumina MiniSeq at Michigan State University ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified fragments were sequenced using a 150-cycle MiniSeq High Output Reagent Kit (Illumina, FC-420-1002) on an Illumina MiniSeq ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... multiplex genome libraries were prepared using the Nextera XT DNA library preparation kit (Illumina, San Diego, CA, USA). The genomic library was quantified using a Qubit fluorometer dsDNA HS kit (Life Technologies Carlsbad ...
-
bioRxiv - Cell Biology 2023Quote: ... The nuclear pellet was resuspended in transposition reaction mix using the Tagment DNA Enzyme and Buffer Kit (Illumina) as per manufacturer protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Then the libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions and sequenced on an Illumina HiSeq X Ten platform and 150 bp paired-end reads were generated ...
-
bioRxiv - Physiology 2024Quote: ... Ribosomal RNA was removed from samples using the Ribo-Zero rRNA removal kit (Illumina, San Diego, CA, USA). Sequencing libraries were prepared using the TruSeq RNA Library Preparation Kit v2 (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing libraries were prepared using Illumina TruSeq Stranded Total RNA Library Prep Ribo-Zero Gold kit (Illumina). Transcriptomic analyses on bulk tissues were performed as previously described 52 ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced on a NextSeq 550 using a NextSeq 500/550 High Output v2.5 75 cycle kit (Illumina) using custom sequencing primers NP0494-NP0497 ...
-
bioRxiv - Microbiology 2023Quote: Sequencing libraries were prepared from total RNA using the TruSeq RNA Library Kit v2 (Illumina; San Diego, USA), with indexed adaptors for multiplex sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were pooled at equimolar concentrations and run on the MiSeq Micro V2 300 cycle kit (Illumina, PE150) using 5 pM with 20% PhiX ...
-
bioRxiv - Microbiology 2023Quote: ... The recovered DNA fragments were sequenced using the MiSeq 500PE v.2 kit (Illumina, San Diego, CA, USA). Short-read sequences from each PCR fragment were assembled using Spades v 3.1(31) ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were prepared (Nextera XT DNA Library Preparation kit) and sequenced on an Illumina NextSeq 500 platform (Illumina, San Diego ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library was sequenced using a TG NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina, 20024911). Custom primers were spiked in with the Illumina primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transcriptome capture based libraries with the TruSeq RNA Access Library Prep Kit (Illumina, cat# RS-301-2001). All protocols were performed following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on an Illumina NextSeq 500 instrument with a High Output v2.5 reagent kit (Illumina # 20024906).
-
bioRxiv - Cancer Biology 2023Quote: ... in single-end mode using the NextSeq 1000/2000 P2 Reagents (100 Cycles) kit (Illumina, cat. no. 20046811). See Supplementary Table 9 for a summary of sequencing statistics.
-
bioRxiv - Cancer Biology 2023Quote: ... amplicons were pooled and sequenced on the NextSeq 550 platform (Nextseq 500/550 Mid Output Kit v2.5, Illumina, for primers see Supplementary Data Set 1).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the QuantSeq 3′mRNA-Seq Library Prep Kit-FWD by Illumina (Lexogen, Vienna, Austria), using 500 ng of total RNA ...
-
bioRxiv - Systems Biology 2023Quote: ... The sequencing library was constructed using the Nextera XT DNA Library LT kit (Illumina, San Diego, CA, USA), according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Thereafter cDNA libraries were made using an Illumina TruSeq Stranded total Library Prep Kit (Illumina, San Diego, US) in combination with TruSeq RNA UD Indexes (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Pooled male and pooled female libraries were constructed using a Truseq nano kit (Illumina, ref. FC-121-4001) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA sequencing libraries were prepared using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... RNA-seq libraries were prepared from 500ng of RNA using TruSeq stranded total RNA library preparation kit (Illumina) and barcoded libraries were combined and submitted for sequencing (paired-end 50 cycles on a HiSeq6000 ...
-
bioRxiv - Plant Biology 2023Quote: Transcriptome libraries were prepared following the instructions of TruSeqTM RNA sample preparation Kit (Illumina, San Diego, CA, USA). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared for sequencing using a TruSeq Stranded mRNA sample prep kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... A cDNA library was prepared from each RNA sample using the Illumina TruSeq RNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA-seq libraries (strand-specific, paired end) were prepared with the TruSeq RNA sample prep kit (Illumina). One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina) ...