Labshake search
Citations for Illumina :
451 - 500 of 775 citations for Cytomegalovirus Cell Lysate Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... libraries were prepared (384 cells per library) using the Illumina Nextera XT kit (Illumina Inc, San Diego, CA, USA). Index v2 sets A ...
-
bioRxiv - Microbiology 2021Quote: ... Sample libraries were pooled and diluted to 200pm and 100µl of this diluted sample was loaded onto a flow cell for NGS using an iSeq 100 (Illumina). Sequences were assembled using reference mapping with paired ends in Geneious R10 (Biomatters ...
-
bioRxiv - Developmental Biology 2020Quote: ... Biological triplicates or duplicates (Table S3) of RNA from each cell line were sequenced on a HiSeq 2500 (Illumina) using 75bp paired-end sequencing.
-
bioRxiv - Genomics 2021Quote: ... High quality samples were then sequenced to a minimum of 50,000 reads per cell on a NextSeq 500 sequencer (Illumina) using a 75-cycle High Output kit using a custom read1 primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).
-
bioRxiv - Genetics 2020Quote: ... and sequencing on a MiSeq with a 600-cycle flow cell (MiSeq Sequencing Kit v3, 600 bp, Illumina, Inc.) were performed according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2021Quote: ... Single cell libraries were multiplexed into a single lane and were sequenced at a target read depth of 100,000 reads/cell using a NovaSeq sequencer (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell populations were then processed for next-generation sequencing as previously described18 and sequenced on a HiSeq-4000 (Illumina). Reads were analyzed by using the MAGeCK pipeline as previously described19 ...
-
bioRxiv - Neuroscience 2022Quote: ... on a single flow cell using the 300-cycle S4 Reagent kit (2×150 bp paired-end reads; Illumina).
-
bioRxiv - Developmental Biology 2022Quote: Single cell libraries were sequenced using Illumina NextSeq 500/550 and NovaSeq 6000 sequencing systems (Illumina, San Diego, CA). The generated binary base call (BCL ...
-
bioRxiv - Cell Biology 2022Quote: ... Bulk sequencing was run on a NovaSeq 6000 instrument using one lane of an S4 v1.5 flow cell (Illumina), 2B paired-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Single cells were dispatched into a 96-plate well containing 5μL 1x lysis buffer containing Murine RNase inhibitor (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina).
-
bioRxiv - Genomics 2022Quote: ... The library was then loaded onto an iSeq i1 V2 reagent cartridge with a 300-cycle flow cell (Illumina) with 5% Phi X and run for 290 cycles in a single direction on an Illumina iSeq 100 (see Supplementary Table 2 for number of sequencing reads).
-
bioRxiv - Neuroscience 2022Quote: ... Next-generation sequencing (VIB Nucleomics Core) of the single-cell libraries was carried out on a NovaSeq 6000 (Illumina) platform with the following read configuration ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 20 libraries containing 95 biological replicates were sequenced targeting 90% mRNA and 10% hashtag oligo library (50,000 reads/cell) on a HiSeq4000 or NovaSeq6000 (Illumina) platform with the recommended read lengths by 10X Genomics workflow.
-
bioRxiv - Microbiology 2022Quote: ... Samples were equimolarly pooled and sequenced on NextSeq™ 500 High Output Kit v2.5 (75 cycles) flow cell (Illumina) with 1 x 75 bp read length.
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The captured fragments were pair-end sequenced by 101 bp reading using NovaSeq 6000 with S4 flow cell (Illumina). Sequenced reads were aligned to reference human genome (GRCh37/hg19 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The capture libraries were sequenced in the iSeq 100 using the i1 Flow Cell and Reagent Cartridge v2 (Illumina) for 300 cycles ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared according to the 10x Genomics Single Cell ATAC v1.1 protocol (CG000209) and pooled for sequencing on a NextSeq500 instrument (Illumina) (Read1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The snRNA-seq library were constructed with 10x Genomic protocol (Chromium Single Cell 3’ Reagent Kits v3.1User Guide) and sequenced by Illumina NovaSeq.
-
bioRxiv - Genomics 2023Quote: ... The cDNAs from each cell were pooled and a library was generated and sequenced with a NovaSeq 6000 (Illumina). We sequenced two biological replicates to a sequencing depth of ∼1 billion reads each ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA and plasmid DNA libraries were sequenced using a 50 cycle SP flow cell on a NovaSeq 6000 (Illumina) using custom sequencing primers (Table S4).
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were loaded onto an Illumina MiSeq using a 2×300 v3 flow cell (Illumina, San Diego, CA) and sequenced to an average depth of 87,099 reads per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single-cell libraries were generated using 10X Genomics Chromium Single-cell 3’ Library RNA-Seq Assays protocols targeting 8,000 cells from each fraction were sequenced on the NovaSeq sequencer (Illumina). The scRNA-seq data were analyzed with the Partek Flow software (Partek Inc) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15000 cells/sample for mESC were treated with Tagment DNA Buffer 2x reaction buffer with Tagment DNA Enzyme (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared using the single cell 30 Protocol as per manufacturer’s instructions and sequenced on a NovaSeq instrument (Illumina) with 26 bases for read 1 and 98 bases for read 2.
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Genomics 2023Quote: ... the sequencing library was prepared with the Chromium Next GEM Single Cell ATAC Reagent Kits v1.1 (10x Genomics, CG000209) and sequenced on the NovaSeq 6000 sequencer (Illumina).
-
bioRxiv - Genomics 2023Quote: ATAC-seq libraries were prepared from 25,000 cells following the Omni-ATAC protocol 46 and using the Tagment DNA Enzyme and Buffer Kit (Illumina). Samples were pooled and run in one HiSeq lane.
-
bioRxiv - Immunology 2024Quote: ... Live purified CD4+ T cells were processed using OMNI-ATAC protocol and libraries sequenced using NextSeq 500 sequencer (Illumina).
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Single-cell RNA-sequencing libraries of the cDNA were prepared using the Nextera XT DNA library prep kit (Illumina). Libraries were multiplexed and sequenced in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... including PCR cycles (12 cycles for cDNA amplification of 5000 cells and 14 cycles for index PCR. E13.5GE libraries from Evf2+/+and Evf2TS/TS were sequenced on the Illumina NovaSeq 6000 (Sequencing Core Facility at the La Jolla Institute).
-
bioRxiv - Neuroscience 2024Quote: ... Samples were sequenced to a target read depth of ∼160 million paired end reads per library (19,291 reads/cell on average) using Illumina NovaSeq (Illumina). Library preparation and sequencing were performed at the KU Leuven Genomics Core (https://www.genomicscore.be/).
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were prepared using a Chromium Single Cell 3’ Library & Gel Bead kit v2 (10x Genomics, PN-120237) and sequenced using a NextSeq 500 (Illumina). The mean number of reads per cell was approximately 25,000 and the median number of genes detected per cell was approximately 2,000.
-
bioRxiv - Microbiology 2020Quote: ... The samples were clustered on a flow cell and 50 cycle paired-end sequencing was performed on an Illumina HiSeq 2000 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... 75-bp single-end sequencing was performed on 12 multiplexed libraries pooled together in one flow cell using a NextSeq 500 high output sequencer (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Totally 3 μg of total RNA was ligated with 5′- and a 3′-adaptors sequentially with TruSeqTM Small RNA (or Stranded Total RNA in the case of cancer cells) Sample Prep Kit (Illumina). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Indexed sequencing libraries were constructed using the Chromium Single-Cell 3’ library kit (10X Genomics) and sequenced on NovaSeq 6000 (Illumina) with the following parameters ...
-
bioRxiv - Immunology 2021Quote: ... Peptides carried by the MCRs from sorted cells were amplified from cDNA by RT-PCR using the peptide flanking regions and sequenced on a miniSeq (Illumina). Sequences from the Illumina output files were trimmed ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were generated using Kapa Biosystems library preparation kit (#KK8201) and multiplexed libraries were sequenced on a 1×75 High output flow cell on the NextSeq550 platform (Illumina). Reads were filtered and trimmed to remove adapter-derived or low-quality bases using Trimmomatic and checked again with FASTQC ...
-
bioRxiv - Developmental Biology 2021Quote: ... Chromium Single Cell 3’ v2 single cell RNA-Seq of poly A selected mRNA kit (10X Genomics) and Sequencing was processed on NextSeq 500 (Illumina). Bioinformatics base call by bcl2fastq v ...
-
bioRxiv - Immunology 2019Quote: VH and VL libraries from sorted B cell were subjected to NGS on the MiSeq platform with the reagent kit V3 2×300 bp paired-end (Illumina), using an input concentration of 16pM with 5% PhiX.
-
bioRxiv - Developmental Biology 2022Quote: 25.000 FACS-sorted cells were collected and used for ATAC Library preparation using Tn5 Transposase from Nextera DNA Sample Preparation Kit (Illumina). The cell pellet was resuspended in 50 µl Lysis/Transposition reaction (12.5 µl THS-TD-Buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a paired-end library was constructed using Illumina DNA Prep (earlier known as Nextera DNA Flex Library Prep) and sequenced on NovaSeq 6000 (NovaSeq SP 150bp Paired-end Flow Cell, Illumina) at the Biomedical Sequencing Facility (BSF ...
-
bioRxiv - Microbiology 2020Quote: DNA extracted from the three cell lines was genotyped on the 220k semi-custom CanineHD array (Illumina, San Diego, CA). Genotype data were managed in PLINK 1.9 (www.cog-genomics.org/plink/1.9/ ...
-
bioRxiv - Immunology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...