Labshake search
Citations for Bioline :
351 - 400 of 948 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genotyping PCR on genomic DNA was performed using the MyTaq DNA Polymerase system (Bioline, cat. no. BIO-21105). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were size separated by gel electrophoresis on a gel composed of 2% DNA grade agarose (Bioline) in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Genetics 2020Quote: ... SensiFAST SYBR No-ROX kit from Bioline, and a Biorad CFX Connect instrument ...
-
bioRxiv - Neuroscience 2021Quote: ... Bioline cDNA synthesis kit (Bioline, London, UK) was utilised to synthesize cDNA from 1 μg of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline) was used for qPCR reactions ...
-
bioRxiv - Microbiology 2021Quote: ... or SensiFAST SYBR Hi-ROX kit (Bioline). Reactions were run using Applied Biosystems 7500 fast RT-PCR machine (Thermofisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... with SensiFAST SYBR Lo-ROX Kit (Bioline). Cycling parameters were 95°C for 3 min ...
-
bioRxiv - Genomics 2021Quote: ... ans Isolate II Genomic DNA kit (Bioline) was used to extract genomic DNA from 1×107 cells ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Lo-ROX kit (Bioline). Melt curve analysis was performed ...
-
bioRxiv - Pathology 2023Quote: ... using SensiFAST SYBR NO ROX kit (Bioline). Fluorescent dye intensity was analyzed and quantified with linear regression ...
-
bioRxiv - Plant Biology 2023Quote: ... using ISOLATE II RNA mini kit (Bioline). cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... using the SensiFAST SYBR & Fluorescein Kit (Bioline), on a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2023Quote: ... or Isolate II RNA mini kit (Bioline). DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ISOLATE II RNA Mini Kit (Bioline) was used to extract RNA from CRC patient samples following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were carried out using 1.5 mM MgCl2 and 1X NH4 buffers for 1U of BioTaq polymerase (Bioline), 0.2 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR and RT-qPCR were performed according to the manufacturer’s protocols using MyTaq™ Red Mix (Bioline/BIOCAT) for RT-PCR and GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The genomic regions flanking the nuclease target sites were PCR amplified using MyTaq™ DNA Polymerase (Bioline, https://www.bioline.com/) and primers listed on Table S3 ...
-
bioRxiv - Microbiology 2021Quote: ... 2μL were used as template for genomic PCRs in a 50 μL reaction with Velocity DNA Polymerase (Bioline#21098) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR was performed (10 cycles) to amplify the tagmented DNA with sequencing adapters using 2x MyTaq (BIO-25041; Bioline). The PCR products were cleaned using Serapure beads and pooled together prior to sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: For each reaction 1μL of gDNA solution was suspended in a PCR tube with 2μL of MyTaq red reaction buffer (5x; Bioline), 1µL of pooled primers/oligonucleotides (final concentration of each primer 10μM or 5μM for Ubc-Cre) ...
-
bioRxiv - Systems Biology 2024Quote: ... Each 20 µl RT reaction was amplified in a 100µl PCR reaction with MyTaq Red mix (#BIO-25043; Bioline). The second PCR reaction was performed using 10 µl of the product of the previous reaction in a 100 µl reaction using the same index variant primer and index variants of 437JvA (containing the S1 ...
-
bioRxiv - Microbiology 2021Quote: For quantification of cellular TMPRSS2 and GAPDH expression cDNA synthesis and qPCR were performed according to the manufacturer’s instructions using the SensiFast cDNA kit and SensiFAST SYBR qPCR kit (both from Bioline). The qPCR was run on a StepOnePlus realtime PCR cycler (Thermo ...
-
bioRxiv - Immunology 2022Quote: Total mRNA from obtained tissues and RAW 264.7 macrophages was extracted using a RNA extraction kit (ISOLET II RNA Mini Kit, Bioline). cDNA was synthesized from 1 μg of RNA using a PrimeScriptTM RT reagent kit (Lifegene ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted using the NucleoSpin RNA XS kit (Machery-Nagel) and cDNA was generated using the SensiFast cDNA synthesis kit (BioLine). Quantitative PCR (qPCR ...
-
bioRxiv - Immunology 2024Quote: ... qPCR reaction was performed with 100 ng of cDNA per sample using the kit SensiFAST Probe Hi ROX kit (BIO-82005; Bioline). The expression of IL7RB was assessed with the TaqMan probe Mm00434295 (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... qPCR reaction was performed with 100 ng of cDNA per sample using the kit SensiFAST SYBR Hi ROX kit (BIO-92005; Bioline).
-
bioRxiv - Evolutionary Biology 2020Quote: ... lyrata PER plants as above and a short section of ASY3 was PCR amplified using 0.5 μM primers (S5 Table) and MyTaq™ Red Mix (Bioline). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were generated from 200 ng genomic DNA (gDNA) using junction-specific primers (Table S4) by a two-step nested PCR with Velocity polymerase (Bioline). The first PCR reaction was performed for 15 cycles with 60 °C annealing and 30 s elongation and then purified with AMPure XP PCR beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons for sequencing were generated by PCR using degenerate primers (see Supplemental Table 1) for each locus using My Taq HS mix (Bioline) and gel purification ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was then used to generate the probe template by standard PCR using the MyTaq™ HSRED DNA Polymerase (Bioline) and opsin specific primers (listed in Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μL of DNA was used in a PCR reaction using 0.3 μΜ primers and 5U of MyTaq DNA polymerase (Bioline).
-
bioRxiv - Genetics 2021Quote: ... cCREs and promoters were amplified from mouse genomic DNA (extracted fromE14TG2a mESCs, ATCC CRL-1821) by PCR using My-Taq Red mix (#BIO-25044; Bioline) in 384 well plates using automated liquid handling (Hamilton Microlab® STAR) ...
-
bioRxiv - Microbiology 2023Quote: PCR products for the generation of different potential RNase E targets were amplified with MyTaq™ Red Mix 2x (Bioline), and Synechocystis genomic DNA as template (primers T01 to T12) ...
-
bioRxiv - Microbiology 2023Quote: ... A fragment of each gene was individually amplified by polymerase chain reaction (PCR) from the leaf DNA extracts using the MyTaq reaction buffer and polymerase (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... After selection on LB-agar kanamycin plates the resulting colonies were first screened by colony PCR using MyTaq DNA polymerase (Bioline) to check for the presence of the right size insert using T7forward and T7reverese primers ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were tested (n = 24-48) for the loss of the vector (erythromycin susceptibility) and by discriminatory PCR (MyTaq HS - Bioline) with specific oligonucleotides to select mutant over WT genotypes ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...
-
bioRxiv - Genomics 2022Quote: ... Presence of the subfamilies in the genomes of additional strains (Table 1) was tested by PCR using the MyTaq polymerase (Bioline) and the primers listed in Sup ...
-
bioRxiv - Cell Biology 2022Quote: ... The resulting cDNA was subjected to real-time PCR in a Rotorgene 6000 (Corbett Life Science, New South Wales, Australia) using Immomix (2× dilution; Bioline), SYBR Green I (10,000× dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was performed in a total reaction mixture of 10 μL containing 1x SensiFast master mix (Bioline, Meridian Bioscience), 0.5 μM of reverse and forward primers ...
-
bioRxiv - Microbiology 2022Quote: ... IS2404 real-time PCR mixtures contained of 10.0□μl of 2x SensiFast Probe NO-ROX mix (BioLine Cat# BIO-86005), 3.2□μl of nuclease-free water ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Microbiology 2024Quote: ... Germany).31 Samples were previously heated to 90 °C for 5 minutes before the addition of the PCR Master Mix and MyTaq polymerase (MyTaqTM Mix, Bioline). For 16S rDNA amplification ...