Labshake search
Citations for Bioline :
201 - 250 of 948 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline). Reaction mixes contained 5 μl 5x MyTaq Reaction Buffer ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using MyTaq HS Red Mix (Bioline) with 66°C annealing and 15s elongation ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... and RT-PCR performed using MyTaq DNA polymerase (Bioline). Fifty cycles of PCR were performed in order to identify low expressed transcripts ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... with SYBR Green Real-Time PCR Master mix (Bioline) in 96 well optical reaction plates (Axygen ...
-
bioRxiv - Neuroscience 2020Quote: PCR products were generated with BIOMIX red (BIOLINE, London, UK) and 1 μl of the respective restriction enzyme was added directly to the final PCR product for RFLP analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with MyTaq DNA or Myfi Polymerases (Bioline) and primers were designed (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA was PCR amplified using the MyTaq polymerase (Bioline). DNA was sonicated to an average size of 300bp and adaptors were removed by AlwI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR analysis was performed using Immolase DNA polymerase (Bioline) and fragments were separated on 2% argarose gels ...
-
bioRxiv - Developmental Biology 2021Quote: ... Every clone was genotyped by PCR (MangoTaq, Bioline, Cat.N. 25033) (primers listed in Supp ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed with Sensimix SYBR Green no-ROX (Bioline) on a Corbett Rotor-Gene 6000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR was performed using SYBR green supermix (Bioline) as per the manufacturer’s instructions on a CFX384 Touch real-time PCR detection system ...
-
bioRxiv - Physiology 2022Quote: ... Each PCR reaction contained 10µl of MyTaqRed Mix (Bioline, C755G95), 350nM of each primer ...
-
bioRxiv - Cell Biology 2024Quote: ... Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline), using primers surrounding the genomic target sites ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed according to the manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase ...
-
bioRxiv - Neuroscience 2024Quote: ... Semiquantitative RT-PCR reactions were performed using Biomix Red (Bioline) using 50 ng cDNA and 0,5 µM of specific primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 target sites within the AAVS1 locus were PCR amplified in a 25 or 50 μL reaction volume per sample using high-performance RANGER PCR Mix (Bioline USA, Inc., Memphis, TN, USA) or PlatinumTM SuperFiTM PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DamID PCR buffer consisted of 1.36x MyTaq™ Buffer (Bioline) and 1.06 μM of the DamID PCR primer (Adr_PCR ...
-
bioRxiv - Genetics 2021Quote: ... target genomic regions were amplified by PCR with BioMix Red (Bioline), sent for Sanger sequencing by MCLAB (South San Francisco ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR was performed with 20 µL Mango Mix™ (Bioline), 0.25 µM of each primer and 2 µL of DNA template in a final volume of 40 µL ...
-
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complexbioRxiv - Molecular Biology 2020Quote: ... Semi-quantitative PCR was carried out with MyTaq Red Mix (Bioline). Quantitative real time PCR was performed with 16 ng of cDNA per reaction with GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... With a standard qualitative PCR (0.125 My Taq™ polymerase (Bioline), 5μl 5x buffer ...
-
bioRxiv - Immunology 2021Quote: ... The PCR reactions were assembled using 45 μL master mix (Bioline) containing 2x buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Routine PCR genotyping of was performed using MyTaq Red mix (Bioline) and using the mentioned primers in 1:0.5:1 combination ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of DpnII-digested fragments using MyTaq (Bioline, BIO-21112) enriched for methylated fragments before samples were sonicated and prepped for sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 12.5 µl of 2X BioMix PCR master mix (Bioline, UK), 0.75 µl of 0.3 µM forward and reverse primer (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... and used to perform a SYBR-based real-time PCR (BioLine) with primers (Table 1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... For real-time PCR SYBR Green Master mix (Bioline BIO-94020) was used ...
-
bioRxiv - Immunology 2022Quote: ... Final PCR products were cleaned with 0.8V JetSeq Clean Beads (Bioline) and PCR yield measured with a Quant-it PicoGreen ds DNA assay (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using 2X Taq-based Master Mix (Bioline) and TaqMan gene expression assays (Applied Biosystems) ...
-
bioRxiv - Immunology 2020Quote: ... qRT-PCR was done using 2X Taq-based Master Mix (Bioline) and TaqMan gene expression assays (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... and quantitative PCR was run using SensiFAST Sybr Master Mix (Bioline). The primers used to detect GFP were a1 5′-caagggcgaggagctgttca-3′ and 5′-tgaacttgtggccgtacgtcg-3′ (GFP7) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were performed using MyTaq™ Red DNA Polymerase (Bioline) in a Bio-Rad® thermocycler with the following program ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative PCR was performed using 2X Taq based Master Mix (Bioline) and Taq Man gene expression assays (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... and a quantitative PCR was performed using SensiFast SYBR (Bioline, 98020) and Bio-Rad CFX Connect thermocycler ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The targeted region was amplified by PCR (MyTaq Red mix, Bioline) from 100 ng of genomic DNA ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were done using 2x SensiFAST Mix (Bioline, London, UK) and analysed in a Lightcycler 480 II (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... For real-time PCR SYBR Green Master mix (Bioline BIO-94020) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Routine PCR genotyping of was performed using MyTaq Red mix (Bioline) and using the mentioned primers in 2:1:1 combination ...
-
bioRxiv - Cancer Biology 2024Quote: ... and genotyping PCRs were performed with MyTaq HS Red Mix (Bioline) using the following FBXO22 genotyping primers ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR was performed using MangoMix with MangoTaq (Bioline, cat# C755G90), for 34 cycles of ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were generated using BioMix™ Red (Bioline, Bio-25006) and were subsequently incubated with the respective restriction enzyme (BioLabs ...