Labshake search
Citations for Bioline :
201 - 247 of 247 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR was performed (10 cycles) to amplify the tagmented DNA with sequencing adapters using 2x MyTaq (BIO-25041; Bioline). The PCR products were cleaned using Serapure beads and pooled together prior to sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was suspended in 100 μl of preheated elution buffer G (ISOLATE II Genomic DNA kit, Bioline Meridian). The DNA quality and quantity was checked by Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... zona-less E2.5 and E3.5 embryos were placed into 10 µL of DNA lysis buffer (1X MyTaq Red Mix, Bioline, #25044) complemented with 0.2 µL of 10 mg/mL proteinase K (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA extraction from tail snips and genotyping PCR reactions were performed using MyTaq Extract-PCR kit (Bioline, Taunton, MA). All the mice were genotyped by the fragment PCR method as indicated in the Jackson Laboratory website ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified RNA was then reverse transcribed into complementary DNA (cDNA) with the SensiFAST™ complementary cDNA synthesis Kit (Bioline) and used in qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was done using 10 ng (broth culture) or 100 ng (fecal samples) of genomic DNA as template with SYBR Green Real-Time qPCR reagents (Bioline), primers at a final concentration of 1 μM ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were generated from 200 ng genomic DNA (gDNA) using junction-specific primers (Table S4) by a two-step nested PCR with Velocity polymerase (Bioline). The first PCR reaction was performed for 15 cycles with 60 °C annealing and 30 s elongation and then purified with AMPure XP PCR beads (Beckman Coulter) ...
-
bioRxiv - Physiology 2020Quote: ... Genomic DNA extraction from tails snips and genotyping PCR reactions were performed using MyTaq Extract-PCR kit (Bioline, Taunton, MA). Mice were genotyped using a fragment PCR method with the primers shown in the table below and indicated on the Jackson Laboratory website ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using 2 µg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was then used to generate the probe template by standard PCR using the MyTaq™ HSRED DNA Polymerase (Bioline) and opsin specific primers (listed in Table S2 ...
-
bioRxiv - Genetics 2019Quote: ... We tested the primers on DNA extracted from the liver of Mongolian gerbil and fat sandrat using the MyTaq Red Mix (Bioline). In each 25ul PCR reaction ...
-
bioRxiv - Microbiology 2019Quote: ... a total volume of 25μL was prepared as mastermix with 5μL as DNA template and 20μL constituting of My Taq ™ Red Mix (Bioline; UK) 12.5μL ...
-
bioRxiv - Immunology 2021Quote: ... Complementary DNA was synthesized using 2 μg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cCREs and promoters were amplified from mouse genomic DNA (extracted fromE14TG2a mESCs, ATCC CRL-1821) by PCR using My-Taq Red mix (#BIO-25044; Bioline) in 384 well plates using automated liquid handling (Hamilton Microlab® STAR) ...
-
bioRxiv - Microbiology 2022Quote: ... and conducted at 100V for 30 min with product size approximated using HyperLadder II 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Microbiology 2022Quote: ... 500-ng portions of DNA extracted from each larva were subjected to qPCR using the SensiMic SybR Green kit (Bioline). Forward (5′-ACTTCCGCAATGGACGTTAC-3′ ...
-
bioRxiv - Microbiology 2023Quote: ... A fragment of each gene was individually amplified by polymerase chain reaction (PCR) from the leaf DNA extracts using the MyTaq reaction buffer and polymerase (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 ng of total RNA was converted to complementary DNA (cDNA) using SensiFASTTM cDNA synthesis kit following manufacturer instructions (Bioline) and qPCR performed using SensiFAST™ SYBR® Lo-ROX Kit following manufacturer instructions (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... After selection on LB-agar kanamycin plates the resulting colonies were first screened by colony PCR using MyTaq DNA polymerase (Bioline) to check for the presence of the right size insert using T7forward and T7reverese primers ...
-
bioRxiv - Neuroscience 2024Quote: ... 150 ng of total RNA was converted to complementary DNA (cDNA) using SensiFASTTM cDNA synthesis kit following manufacturer instructions (Bioline) and qPCR performed in technical triplicate using SensiFAST™ SYBR® Lo-ROX Kit following manufacturer instructions (Bioline ...
-
bioRxiv - Developmental Biology 2021Quote: ... For methylated DNA amplification by PCR each one of these products was mixed with 118 μl of DamID PCR buffer and 2 μl (10 units) of MyTaq™ DNA polymerase (Bioline) and were aliquoted at 40 μl in 4 different 0.2 ml PCR tubes ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... We synthesized complementary DNA (cDNA) from 100ng of RNA in a 40μl reaction containing 100 units of Tetro Reverse transcriptase (Bioline, Taunton, MA), 8μl of 5X RT buffer ...
-
bioRxiv - Pathology 2020Quote: Wheat curl mite DNA was extracted from single mites using the MyTaq™ Extract-PCR Kit (Bioline Meridian Bioscience, London, UK)) according to the manufacturer’s recommendations with the exception of the amount of starting material being less than 3 mg ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Converted DNA was subjected to 12 cycles of PCR amplification to enrich for adapter-ligated fragments with MyTaq Mix (Bioline Inc.), during which each sample was also barcoded with unique sequence tags ...
-
bioRxiv - Molecular Biology 2023Quote: ... expanded and initially screened for correct integration using homology- arm spanning PCRs (Immolase DNA polymerase, Bioline, supplemented with Q solution, Qiagen). Genotypes of positive clones were confirmed by Sanger sequencing ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... We synthesized complementary DNA (cDNA) from 100 ng of RNA in a 40µl reaction containing 100 units of Tetro Reverse transcriptase (Bioline, Taunton, MA), 8µl of 5X RT buffer ...
-
bioRxiv - Molecular Biology 2020Quote: Complementary DNA (cDNA) used for in situ hybridisation and quantitative PCR (qPCR) was synthesised using the Tetro cDNA synthesis kit (Bioline, London, UK) with oligo-dT primers according to the manufacturers’ instructions.
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using the NucliSENS® EasyMag® (BioMérieux, Marcy l’Etoile, France) or the Isolate II Genomic DNA kit (Bioline, Tennessee, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the qPCR analysis was performed on each DNA sample in duplicates by using SensiFAST™ SYBR® No-ROX Kit (Bioline, UK) and primer sets summarised in table 2 at a final concentration of 1 pM of each primer ...
-
bioRxiv - Microbiology 2021Quote: ... 458/459/JL-D2) in TBE (Tris, boric acid, ethylenediaminetetraacetic acid) and product size approximated using HyperLadderII 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Microbiology 2020Quote: All PCRs were carried out in 25 μl reaction volumes containing 0.05 units of MyTaq™ DNA Polymerase (Bioline Laboratories, London, UK), 1x MyTaq™ Mix (Bioline ...
-
bioRxiv - Microbiology 2019Quote: DNA was extracted from whole female BF post adult and pupal injection using an Isolate II Genomic DNA extraction kit (Bioline, NSW, Australia). Six flies were assayed at each point of time for determination of the relative Wolbachia density ...
-
bioRxiv - Neuroscience 2022Quote: ... a first-round PCR was carried out using 200 ng of template cDNA with My Taq DNA polymerase (Bioline Alexandria, NSW, Australia), initial denaturation at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the Methyl Indexed PCR was performed by mixing 4 µL of ligated DNA with x-Gen Dual combinatorial Indexes (IDT) (125 nM final concentration) and MyTaq RedMix (Bioline, BIO-25048) in a final volume of 40 µL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Physiology 2022Quote: ... All primer pairs were evaluated for specificity and to ensure that they produced only a single band of the appropriate length using MyTaq DNA Polymerase (Bioline, Alexandria, NSW, Australia) and agarose gel electrophoresis.
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were re-evaluated for specificity and to ensure that they produced only a single band of the appropriate length using MyTaq DNA Polymerase (Bioline, Alexandria, NSW, Australia) and agarose gel electrophoresis.
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μl of purified DNA with 10 μl 2x MyTaq HS Mix polymerase (Bioline, Narellan, NSW, Australia) and 1 μl (5 μM ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...