Labshake search
Citations for Bioline :
51 - 100 of 398 citations for PCR Tubes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative Real-time PCR (qRT-PCR) was carried out using SensiFAST™ SYBR® No-ROX One-Step Kit (Bioline) and the results were analysed using the 2−ΔΔCt method (Livak & Schmittgen ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR reactions were resolved in 1 % agarose (Bioline) gels containing 0.5 μg/ml Ethidium Bromide (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCRs were conducted using SensiFast (Bioline, London, UK) on the CFX384 RT-PCR detection system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR machine using the SensiMix SYBR kit (Bioline). Results were quantified using the 2−ΔΔCt method ...
-
bioRxiv - Microbiology 2020Quote: ... The MyTaq One-Step RT-PCR Kit (Bioline) was used to generate and amplify cDNA from viral RNA isolated from nasal wash samples (as above) ...
-
bioRxiv - Physiology 2020Quote: ... PCR was performed with Biomix red kit (Bioline) and PCR products were resolved using the QIAxcelcapillary system (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: ... PCR was performed using a BIOTAQ kit (Bioline). Csf1rMeriCreMer mice were genotyped using iCre-F-YL (5’- GTCTCCAACCTGCTGACTGTGC-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... utilizing SensiFast Lo-ROX qRT-PCR Mastermix (Bioline) in both biological and technical triplicate ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR bands were extracted from the agarose gel and purified using and Isolate II PCR and gel kit (Bioline, London, UK) and sent for Sanger sequencing (GATC Biotech ...
-
bioRxiv - Microbiology 2019Quote: ... One step RT-PCR was also performed to amplify viral RNA from the organs using MyTaq One-Step RT-PCR kit (Bioline, UK) for Sanger sequencing or deep sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT–PCR (qRT–PCR) was carried out using the SensiFast™SYBR Hi-ROX One-Step Kit (Bioline) as described (Wobbe et al. ...
-
bioRxiv - Microbiology 2022Quote: ... A few microliters of each PCR product were run on an agarose gel to assess the success of the PCR reaction and the remains cleaned through an Isolate II PCR and Gel kit (Bioline, USA) and sent for sequencing with primer C1-N-2191 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... For the PCR master mix (MM) MangoTaq DNA polymerase and MyTaq DNA Polymerase were used and all PCR reagents were from Bioline (London, UK). To reduce the PCR inhibitors 0.4 μg μL−1 of bovine serum albumin (BSA ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed with BIOTAQ DNA Polymerase (Bioline, UK) using the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR of cDNA was performed using MyFi Taq (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (Supplementary Table 3 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR was performed with 2x MyTaq HS Mix (Bioline), using the following Hnrnpu primers ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Zoology 2019Quote: ... PCRs included 0.5 U MyTaq HS Mix polymerase (Bioline), 1 μL of DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline).
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR was performed using SensiMix SYBR Green (Bioline) on a QIAGEN Rotor-Gene Q ...
-
bioRxiv - Genetics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline). Reaction mixes contained 5 μl 5x MyTaq Reaction Buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... was carried out using a BioScript PCR kit (Bioline) according to the manufacturer’s instructions in a BioRAD CFX 384 Thermal Cycler (BioRAD ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... and RT-PCR performed using MyTaq DNA polymerase (Bioline). Fifty cycles of PCR were performed in order to identify low expressed transcripts ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using MyTaq HS Red Mix (Bioline) with 66°C annealing and 15s elongation ...
-
bioRxiv - Genomics 2023Quote: ... The PCR product was cut from gel to remove any other undesired products and cleaned with the PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060). The isolated samples were sequenced by Illumina MiSeq for screen 1 (14.3 million reads ...
-
bioRxiv - Immunology 2021Quote: ... obtained from the TaqMan RT-PCR kit (Bioline BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was quantified using SYBR Green PCR master mix (Bioline) and normalized to Hypoxanthine-guanine phosphoribosyltransferase (Hprt ...
-
bioRxiv - Neuroscience 2020Quote: PCR products were generated with BIOMIX red (BIOLINE, London, UK) and 1 μl of the respective restriction enzyme was added directly to the final PCR product for RFLP analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Products were purified (Isolate II PCR and Gel kit, Bioline) and Sanger sequenced (Australian Genome Research Facility ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantitative PCR with the library quantification kit from Bioline Jet Set Library Quantification Kit LoROX (Meridian Bioscience ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with MyTaq DNA or Myfi Polymerases (Bioline) and primers were designed (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA was PCR amplified using the MyTaq polymerase (Bioline). DNA was sonicated to an average size of 300bp and adaptors were removed by AlwI (NEB ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline #BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amplicon PCR reaction was performed using 2x Accuzyme mix (Bioline) and 20 ng of DNA to amplify the barcode using the previously published primers sequences (Bhang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR was carried out using Velocity proofreading DNA polymerase (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR analysis was performed using Immolase DNA polymerase (Bioline) and fragments were separated on 2% argarose gels ...
-
bioRxiv - Developmental Biology 2021Quote: ... Every clone was genotyped by PCR (MangoTaq, Bioline, Cat.N. 25033) (primers listed in Supp ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed with Sensimix SYBR Green no-ROX (Bioline) on a Corbett Rotor-Gene 6000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified using ISOLATE II PCR and Gel Kit (Bioline, Australia) and Sanger sequenced at the Australian Genome Resource Facility (AGRF) ...