Labshake search
Citations for Bioline :
51 - 100 of 189 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Biochemistry 2020Quote: ... 2 µg of total RNA was used to prepare cDNA with SensiFast cDNA synthesis kit (Bioline) according to the manufacturer’s instructions and diluted 1:6 with DNAse/RNAse-free water (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was converted to cDNA using the SensiFAST cDNA kit (#BIO-65053, BioLine) with 10 μL of RNA extract per reaction following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...
-
bioRxiv - Cancer Biology 2020Quote: The assay consists of 10 μl of reaction volume including 5 ul of 2X buffer (Bioline, Bio-11060), 2 ul of Primer/probe mix in 1xTE with final concentration of 100 nM-600 nM of primers and 50 nM – 500 nM of probes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µg RNA (fractionation) or 11µl RNA (RNA immunoprecipitation) was converted to cDNA using BioScript Reverse Transcriptase (Bioline). Primers used in this study are provided in Supplementary Table 3 ...
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were size separated by gel electrophoresis on a gel composed of 2% DNA grade agarose (Bioline) in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Genetics 2022Quote: The full exon 3 of PRNP gene (771 bp) of all animals was amplified by PCR using MyTaq™ Red Mix (Bioline Meridian Life Sciences-BIO-25043). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Genetics 2020Quote: ... 1 μl forward and reverse primers (10 mM) and 0.5 μl (5 U/μl) BioTaq DNA polymerase (Bioline, London) and amplified using PCR thermal cycler (BiometraTOne ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Genetics 2021Quote: ... and then digested with proteinase K (20 μg per sample at 56°C for 2 h; Bioline, cat. # 37084), and electrophoresed on a 1.5% agarose gel to verify that the majority of fragments were 100-400 bp in size ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reactions were performed in a total volume of 25 μl containing 12.5 μl 2 x MyTaq Red (Bioline, UK), 0.5 μl of each 10 μM primer stock ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was made from 2 μg of RNA using the Tetro cDNA synthesis kit with DNase treatment according to manufacturer’s instructions (Bioline). cDNA was diluted 1 to 5 into RNAse free water to a total of 100 μl ...
-
bioRxiv - Genetics 2022Quote: ... Genotyping was performed directly from the lysates with region targeting primers (Supplementary Table 2) and MyTaq Red Mix (Bioline) followed by gel electrophoresis to reveal biallelic knockout clones ...
-
bioRxiv - Immunology 2021Quote: ... Participants had positive rapid diagnostic test for malaria (SD BIOLINE, Malaria Ag P. f., Abbott) at the field site ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... 1 µg RNA (iNeurons samples) or 2 µg RNA (Drosophila samples) was converted to cDNA using BioScript Reverse Transcriptase (Bioline). qRT–PCR primers were designed using Origene or Primer-BLAST and validated using a 1 in 4 serial template dilution series (standard curve with R2>0.97) ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using 2 µg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... PCR amplicons were separated using standard gel electrophoresis on 2% metaphor agarose and sized in comparison to a 100 bp Hyperladder (Cat# BIO-33056; Bioline).
-
bioRxiv - Immunology 2021Quote: ... Complementary DNA was synthesized using 2 μg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The resulting cDNA was subjected to real-time PCR in a Rotorgene 6000 (Corbett Life Science, New South Wales, Australia) using Immomix (2× dilution; Bioline), SYBR Green I (10,000× dilution ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of the entry vector was also digested with EcoRI-HF and NheI-HF and the linearised product was purified from a 2% agarose gel using PCR Isolate II PCR and Gel Kit (Bioline). The digested and purified reporter pool was then ligated into 80 ng of the linearised entry vector using Takara ligation kit v1.0 (#6021 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Genetics 2020Quote: ... 4 mM MgCl2 (Bioline); 800nM dNTPs (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Biophysics 2021Quote: Genotyping of ClC-7 KO U2OS clone was performed using an Extract PCR-Kit (Bioline) with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μL of SensiMix™ SYBR® Green Master Mix (Bioline®, Memphis, TE, USA), and H20 in a total volume of 15 μL ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... with a 5μL 5 HyperLadderTM 100bp (Bioline) to confirm product size ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of 5X Mytaq reaction buffer (Bioline, London, UK), 0.2 μl of MyTaq DNA polymerase (Bioline ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5μl of 10 x Buffer (Bioline), 1.25μl of 50mM MgCl2 (Bioline) ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl 2X BioMix Red (Bioline) and ddH2O ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... consisting of 5 μL MyTaq HS DNA Polymerase (Bioline), 0.2 μL of each forward and reverse primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of 2x SYBR green master mix (Bioline), 1μl (5 pmol/μl ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 μl of 5X MyTaq reaction buffer (Bioline, London, UK). The amplification products were analyzed by electrophoresis using a 2% agarose gel.
-
bioRxiv - Microbiology 2019Quote: ... 1 µl of 10 mM dNTP’s (BioLine), and 0.25 µl iProof (BioRad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Plant Biology 2019Quote: ... 0.4 μL 10 μM specific primer pairs (mixture of forward and reverse primers) was mixed with 10 μL SensiFAST SYBR (Bioline) mastermix and 9.6 μL of cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...