Labshake search
Citations for Bioline :
1 - 50 of 189 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Zoology 2019Quote: ... 5’-TAAGCACTTGT CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix (Bioline), 2 μL of DNA template ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 mM MgCl (Bioline, Boston, MA), 1 mM dNTP (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of diluted cDNA were combined with 5 μL SYBR Green (Bioline, Luckenwalde, Germany), 0.2 μL of each forward and reverse primer and 4.6 μL DEPC-water ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 μl of 1:10 diluted cDNA and BIOTAQ™ DNA polymerase (Bioline GmbH) were used in a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline), 0.25 μM each of RamF6 and RamR6 primers (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline, Australia), 0.25 μM of each forward and reverse primer (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... For methylated DNA amplification by PCR each one of these products was mixed with 118 μl of DamID PCR buffer and 2 μl (10 units) of MyTaq™ DNA polymerase (Bioline) and were aliquoted at 40 μl in 4 different 0.2 ml PCR tubes ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed the desired deletions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed deletions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated from cells 3 hours after inducing socRNA expression using TRIsure (Bioline). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... Samples were prepared for qPCR in technical duplicates in 10-μl reaction volumes using SensiFAST SYBR Lo-ROX 2× Master Mix (Bioline, BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 μM and cDNA diluted at 1:20 by volume ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of MyTaq™ 5x reaction buffer (Bioline), 0.08 μL of each primers ...
-
bioRxiv - Microbiology 2021Quote: ... and 2× My Taq Red (Bioline, Taunton, MA, USA). The PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Immunology 2022Quote: ... 3 µL of 5x PyroTaq EvaGreen qPCR Mix Plus with ROX (Cultek Molecular Bioline, Madrid, Spain), and transcript-specific forward and reverse primers at a 10 μM final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... including 10 μl of 10 mg/ml BSA solution and 5 μl of HyperLadder 1 kb (BIOLINE), 200 μl of the filtered cell lysates was injected onto the pre-equilibrated SEC column ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL was used as a template in 20 μL qPCR reactions containing 10 μL SensiFAST™ Probe Hi-ROX (Bioline, Cat. No. BIO-82020), 200 nM probe ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 5 - 10 ng DNA was used for amplification with MyTaq Polymerase (Bioline). The PCR cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... cells from the transfection without repair plasmid were collected after 3 days for genome extraction (Bioline #BIO-52066) and PCR (NEB #M0491S ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Plant Biology 2021Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Neuroscience 2022Quote: ... using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation, Alvinston, ON, Canada). Complementary DNA of mRNA was amplified using a pair of specific forward and reverse primers (Supplementary Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 μl of digest were run on 2 % agarose gel (BIOLINE, London, UK) and imaged on a trans illuminator ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the 2× SYBR Green PCR Master Mix (Bioline) with the CFX96 detection system and analyzed with CFX Manager softward (Bio-rad) ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were run on 0.8-2% agarose gels (Bioline, Cat#: BIO-41025), depending on fragment size ...
-
bioRxiv - Plant Biology 2020Quote: ... The digested product was visualized on a 2% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 90 min and the genotype of each line at the SNP position was confirmed according to the product bands on the gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were separated by gel electrophoresis on 2% DNA grade agarose (Bioline) gels in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were set up in total volumes of 10 µl each, containing 5× MyTaq reaction buffer (5 mM dNTPs, 15 mM MgCl2, stabilizers and enhancers) (Bioline, London, UK), 2 µM of each primer ...