Labshake search
Citations for GE Life Sciences :
651 - 700 of 4979 citations for 7 Boc 3 chloro 5 6 7 8 tetrahydroimidazo 1 2 a pyrazine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... packed with Ni2+ nitrilotriacetic acid (NTA)-sepharose (GE Healthcare) were used ...
-
ARL3 Mediates BBSome Ciliary Turnover by Promoting Its Outward Diffusion through the Transition ZonebioRxiv - Cell Biology 2021Quote: ... the bacterially expressed 6×His tagged ARL3 and its variants were purified with Ni SepharoseTM 6 Fast Flow beads (GE Healthcare) and cleaved with thrombin (Solarbio ...
-
bioRxiv - Biochemistry 2022Quote: ... in 1 ml fractions and protein containing fractions were applied to SEC without further concentration using a Superose 6 increase (Superose 6 Increase 10/300 GL, GE Healthcare) which was equilibrated in SEC buffer.
-
bioRxiv - Molecular Biology 2023Quote: ... Images were acquired with 200 ms exposure time every 6 minutes for at least 6 h at 30°C using Softworx (Applied Precision) software ...
-
bioRxiv - Molecular Biology 2024Quote: ... was filtered using a 0.45 µm spin-X centrifuge filter before loading onto a Superose 6 column (Superose 6 10/300GL, GE Healthcare, Sweden) and subsequent processed by SEC-HPLC (Äkta Purifier 10 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the supernatant was transferred to a new tube and mixed with 20 μl of home-made SPRI beads (equivalent of 1 ml of Sera-Mag Magnetic SpeedBeads, carboxylated, 1 μm, 3 EDAC/PA5 (GE Healthcare Life Sciences) in 50 ml of binding buffer containing 10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biophysics 2021Quote: ... Cleaved products were further purified by S-75 size exclusion chromatography (SEC buffer-50 mM sodium phosphate, 50 mM sodium chloride, 1 mM DTT, pH 8) (GE Healthcare Life Sciences). The purity of the protein was inspected using a 15% SDS PAGE (Figure S1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 3-10 (GE Healthcare) and peptides focused for 20 kVh ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 3-10 (GE Healthcare) diluted 1:50 in 5% glycerol ...
-
bioRxiv - Genetics 2021Quote: ... Products of were separated using 6% denaturing sequencing gel for 1 hr at 2000 V and detected at fluorescence filter in the Typhoon FLA (GE Healthcare). Rate of cleavage (nucleotide/minutes ...
-
bioRxiv - Microbiology 2021Quote: ... The His-tag itself and traces of uncleaved protein were subsequently removed by nickel affinity chromatography on 1 ml Ni-Sepharose 6 FF resin (GE Healthcare) pre-equilibrated in buffer A ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting supernatant (∼1 ml) was incubated with 20 µl of dimethyl pimelimidate (DMP) cross - linked IgG Sepharose 6 Fast Flow (GE healthcare) resin for 2 h with gentle rotation at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h at 4 °C and purified on a Superose 6 Increase 10/300 GL column (GE Healthcare) equilibrated with 25 mM sodium phosphate pH7.4 ...
-
bioRxiv - Biochemistry 2021Quote: ... Mer2 constructs were eluted with a lysis buffer containing 1 mM maltose and passed through a 6 mL ResourceQ column (GE Healthcare) equilibrated in 50 mM HEPES pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... Products of were separated using 6% denaturing sequencing gel for 1 hr at 2000 V and detected at fluorescence filter in the Typhoon FLA (GE Healthcare).
-
bioRxiv - Neuroscience 2023Quote: ... Reaction products were electrophoretically resolved on 6% denaturing sequencing gel for 1 hour at 2000 V and detected at fluorescence filter in the Typhoon FLA (GE Healthcare). Nuclease activity quantification compared the densitometric intensity of cleaved versus un-cleaved DNA (ImageQuant ...
-
bioRxiv - Plant Biology 2019Quote: ... and electrotransfered (2 h at 80 V or 16 h at 30 V and 4°C) onto polyvinylidene difluoride membrane (Amersham, GE Healthcare). The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen) ...
-
bioRxiv - Biophysics 2021Quote: ... the sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysates were incubated for 2 h on a spinning wheel at 4°C with 100µl of StrepTactin Sepharose High Performance beads (#28935599, GE Healthcare, USA). Beads were collected by centrifugation (1600 g for 5 min at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: Proteins (200 μl at 2 μM) were separated on a Superdex 200 Increase 10/300 GL column (GE Healthcare Life Sciences) equilibrated in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysed cells were centrifuged 20,000 xg for 30 minutes at 4C and soluble lysate was filtered prior to IMAC purification using 2×5mL His-Trap columns (GE Healthcare) affixed to an Akta Pure ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PAGE gel was exposed to a phosphosimage screen for ∼2 hours and analyzed using a Amersham Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the mixture was centrifuged for 2 mins and the supernatant was desalted by filtration with a Sephacryl S-400 HR column (GE Healthcare), centrifuged at 16 krpm ...
-
bioRxiv - Developmental Biology 2019Quote: ... A total of 96 fractions were collected in a row-wise snaking pattern into a Whatman 2 ml 96-well plate (GE Healthcare), which were then concatenated non-sequentially into a final 24 fractions for proteomic analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was loaded at concentrations ranging from 2 to 16 mg/ml on a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2019Quote: ... Stoichiometric amounts of each core histone were incubated together under high salt conditions (2 M NaCl) and the resulting histone octamer purified using a Superdex 200 gel filtration column (GE Healthcare). Purified 147bp DNA carrying the 601 nucleosome-positioning sequence was a kind gift from the Brockdorff lab ...
-
bioRxiv - Biochemistry 2019Quote: ... the purified sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were concentrated to 2 mL and further purified by size-exclusion chromatography using HiLoad 16/600 Superdex 200 (Ge healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare) column into 20 mM NaPO4 150 mM NaCl pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Biophysics 2021Quote: ... The flow through containing SARS-CoV-2 Mpro was collected and further purified using size exclusion chromatography column (G-100, GE Healthcare,) equilibrated with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mass evaluated using UV as concentration source was 55.7 kDa for the 2 mg/ml sample.The Odinarchaeota samples were analysed by SEC-MALS (100 μl protein complex at 2 mg/ml) were passed over a Superdex 200 10/300 Increase GL column (GE Healthcare), in 20 mM Tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... 100-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 200 or 75 10/300 GL Increase size-exclusion chromatography column (GE Healthcare) in 20 mM Tris HCl ...
-
bioRxiv - Biophysics 2020Quote: ... followed by 2 CV of 100% IEX buffer B using an ÄKTA Pure fast protein liquid chromatography (FPLC) system (GE Healthcare). To determine the point of elution of aSyn from the chromatography column protein fractions which were collected and monitored on absorption at 280 nm were ran on a 4-12% Bis-Tris gel (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was supplemented with 4 mM CaCl2 and stirred for 2 h in 4°C with CaM-Sepharose beads (GE Healthcare), pre-equilibrated with binding buffer (50 mM Tris/HCl pH 7.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gel was washed with the wash buffer and the IF3-bound complexes were eluted by additional incubation of 2 h with the PreScission protease (GE Healthcare) (2 U/μl).
-
bioRxiv - Microbiology 2022Quote: ... or His-NTV-AviTag (80 µl at 2 mg/ml) were injected on a Superdex 200 increase 10/300 GL column (GE Healthcare), equilibrated at 4°C with a buffer containing 25 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... The obtained pellet was resuspended in 2 mL of washing buffer and loaded on top of a 28% (v/v) Percoll (GE Healthcare) continuous gradient with a 0% to 4% (w/v ...
-
bioRxiv - Immunology 2022Quote: SPR screening and affinity measurements of monoclonal Fabs binding to SARS-CoV-2 spike proteins were performed using a Biacore S200 instrument (Cytiva, formerly GE Healthcare) in HBS-EP+ 1X running buffer ...
-
bioRxiv - Biochemistry 2022Quote: Antibody binding to SARS-CoV-2 spike was assessed using SPR on a Biacore T-200 (Cytiva, MA, formerly GE Healthcare) with HBS buffer supplemented with 3 mM EDTA and 0.05% surfactant P-20 (HBS-EP+ ...
-
bioRxiv - Neuroscience 2020Quote: T1-weighted images providing high anatomical detail were acquired on 2 GE 3T Discovery 750× scanners (GE Healthcare, Waukesha, WI, USA) with an 8-channel phased array head coil (scanner 1 N=336 ...