Labshake search
Citations for GE Life Sciences :
401 - 450 of 550 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 100 μL solution of 1.5 mg/mL protein was injected onto a Superdex 200 Increase 10/300 GL (GE Healthcare) column equilibrated in a buffer of 20 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... The solution was filtered and the model degrons were loaded on a HiTrap SP HP 5 ml column (GE Healthcare) in 50 mM ammonium acetate pH 4.5 ...
-
bioRxiv - Biophysics 2022Quote: ... Excess unreacted BADAN was removed by gel filtration by passing the reaction solution through a PD-10 column (GE Healthcare). Labeling efficiency was measured by UV-visible spectroscopy based on extinction coefficients of SLO-1 (ε280 = 132 mM-1 cm-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The solution was then passed over a Superose 6 Increase 10/30 size-exclusion chromatography column (GE Healthcare Life Sciences) that was preequilibrated in 50 mM phosphate buffer pH 7.5 ...
-
bioRxiv - Physiology 2023Quote: ... the membranes were then washed three times with a PBS 0.3% tween solution and incubated with a horseradish peroxidase-conjugated secondary antibody (GE Healthcare) in PBS 0.3% tween 3% BSA for one hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Cell pellets were suspended in 30 µL of an aequous solution containing Tris (50 mM, GE Healthcare, Chicaco, IL, USA), NaCl (150 mM ...
-
bioRxiv - Biophysics 2020Quote: ... the solution was loaded onto a CM-Sepharose column coupled to an Äkta Pure system (GE Healthcare Life Sciences, Brøndby, Denmark). The sample was loaded on a column equilibrated with buffer A (50 mM Tris-HCL ...
-
bioRxiv - Immunology 2021Quote: ... The protein was eluted with 10 mM maltose solution in the lysis buffer and further purified by size exclusion chromatography using Superose 6 10/300 GL column (GE Healthcare) equilibrated with 30 mM HEPES at pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... Aliquots of solution taken at various time intervals (0 – 390 mins) were loaded to a 5mL HiTrap Q HP column (GE Healthcare) equilibrated in buffer (20 mM HEPES pH 7.0 ...
-
bioRxiv - Bioengineering 2021Quote: ... we typically added 20 mL leukocyte products on top of 20 mL Ficoll-Paque solution for density gradient centrifugation from GE Healthcare in a 50 mL Falcon tube and then centrifuged at 800× g at room temperature for 20 min to separate different leukocyte cells ...
-
bioRxiv - Microbiology 2022Quote: ... The infusions were stored over-night at 4°C before the leaves were removed and the aqueous solutions were sterile-filtered (200 μM filter, Whatman/GE Healthcare). Afterwards ...
-
bioRxiv - Immunology 2022Quote: ... The medium of samples collected from the Histrap columns was substituted with PBS solution and then further purified with the Superdex 200 column (GE Healthcare). Lastly ...
-
bioRxiv - Microbiology 2022Quote: The solution containing the proteins was loaded on a prepacked 1 ml or 5 ml His Trap HP Nickel column (GE Healthcare), which had been washed with 5 column volumes of water and equilibrated with 5 column volumes of buffer A (20 mM sodium phosphate ...
-
bioRxiv - Microbiology 2022Quote: ... Erythrocyte lysis was performed using ammonium-chloride-potassium (ACK) buffer and leukocytes were isolated by gradient centrifugation using Percoll solution (GE Healthcare). Lung tissue leukocytes were filtered again and antibody staining for flow cytometry was performed.
-
bioRxiv - Cell Biology 2021Quote: ... Horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence solution (MoBiTec) were used for visualization on an Amersham Imager 680 (GE Healthcare) or a Cawomat 2000 IR apparatus (CAWO solutions).
-
bioRxiv - Biochemistry 2021Quote: ... The buffer salt concentration was diluted to 30 mM NaCl and the solution was flown through a 5 mL HiTrap Q HP (GE Healthcare) and a NiNTA column ...
-
bioRxiv - Biophysics 2020Quote: ... Fixed cells were rinsed three times in warm PBS and incubated 30 min with a blocking solution containing 1% BSA (Bovine Serum Albumine, GE Healthcare) and 5% FBS in PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... the membranes were incubated for 2 h in Can Get Signal Solution 2 (Toyobo) with anti-rabbit or mouse IgG conjugated to horseradish peroxidase (GE Healthcare). After washing twice with TBST ...
-
bioRxiv - Cancer Biology 2020Quote: ... the reaction was quenched by addition of the same EDTA solution and the labeled construct was purified using gel-filtration chromatography (Sephadex G-25, PD10 desalting column; GE Healthcare) into 0.9% saline ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μL of this peptide solution was subjected to SEC analysis by passing through Superdex peptide 10/300 GL column (GE healthcare) connected to Bio-Rad (Biologic Duoflow ...
-
bioRxiv - Immunology 2020Quote: ... An equal volume of buffer (2 mM EDTA in PBS) and blood was mixed and carefully layered over 5ml Ficoll Hypaque solution (GE Healthcare). After centrifugation for 20 min at 900 g (with no break ...
-
bioRxiv - Immunology 2020Quote: ... the surface was saturated with two sequential injections of a 20 μM knob domain solution in HBS-EP buffer (GE healthcare), using a flow rate of 30 μL/min and contact time of 300 seconds ...
-
bioRxiv - Bioengineering 2023Quote: ... PBMCs were isolated from peripheral blood samples of a healthy volunteer by density gradient centrifugation using Ficoll-Paque solution (GE Healthcare) and were freshly transferred to NSG mice ...
-
bioRxiv - Biophysics 2023Quote: ... The solution was concentrated to ∼1 ml and went through gel filtration on Superdex 75 10/300 increase column (GE Healthcare) equilibrated with a buffer containing 20 mM HEPES ...
-
bioRxiv - Bioengineering 2023Quote: ... where 18 mL of blood was mixed with Hanks’ Balanced Salt Solution (HBSS, 14175095, GibcoTM) before being poured onto Ficoll-Paque Plus (GE17-1440-03, GE Healthcare). The layers were separated through centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The final solution was then purified to greater than 95 % purity over a Sephadex S-300HR gel filtration column (GE Healthcare) and buffer exchanged at the same time into binding buffer (20 mM phosphate buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The final solution was then purified to greater than 95 % purity over a Sephadex S-300HR gel filtration column (GE Healthcare) and buffer exchanged at the same time into binding buffer (20 mM phosphate buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated with blocking solution (2.5 % FBS, 200 mM glycine, 0.1 % Triton X-100 in PBS or 2 % bovine serum albumin (GE Healthcare or Calbiochem), 0.01 % Tween 20 (National Diagnostics or Roth ...
-
bioRxiv - Neuroscience 2024Quote: ... and the bands were detected using an immunoreaction enhancing solution (Can Get Signal; Toyobo) and enhanced chemiluminescence (ECL Prime; GE Healthcare). Chemiluminescence signals were digitized using a ChemiDoc MP imaging system (Bio-Rad Laboratories) ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... and the bands were detected using an immunoreaction enhancing solution (Can Get Signal; Toyobo) and enhanced chemiluminescence (ECL Prime; GE Healthcare).
-
bioRxiv - Plant Biology 2024Quote: ... the cleaved tag from the 6xHis-MBP-Pwl2 purification was removed from the solution using a MBPTrap HP dextrin sepharose column (GE Healthcare) and subsequently eluted using SEC buffer supplemented with 10mM maltose.
-
bioRxiv - Biochemistry 2023Quote: ... The desalted solution containing protein of interest was applied to a HiTrap Q HP 5 mL column (GE Healthcare UK Ltd.) pre-equilibrated with the HiTrap binding buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The desalted solution containing protein of interest was applied to a HiTrap Q HP 5 mL column (GE Healthcare UK Ltd.) preequilibrated with the HiTrap binding buffer ...
-
bioRxiv - Microbiology 2023Quote: ... from 3 different healthy donors to avoid unique donor bias on type cells effects and extracted using Ficoll-Plaque Plus solution (GE Healthcare). PBMCs were re-suspended in RPMI-1640 medium (Lonza Bioscience ...
-
bioRxiv - Biophysics 2022Quote: ... Aggregates were removed by centrifugation (20 min, 48000xg, 4° C) and the protein solution loaded onto a 6 ml Resource S column (GE Healthcare) equilibrated in 20 mM MOPS-NaOH pH 7.0 ...
-
bioRxiv - Biophysics 2022Quote: Working solutions for light scattering were filtered through Whatman® 0.02 μm aluminum oxide filters (GE Healthcare Bio-Sciences, Pittsburgh, PA). All polystyrene bottles (Nalgene ...
-
bioRxiv - Biophysics 2023Quote: ... The fixed cells were rinsed three times in warm PBS and incubated for 30 min with a blocking solution containing 1% BSA (GE Healthcare) and 5% FBS in PBS ...
-
bioRxiv - Immunology 2024Quote: ... Samples were centrifuged at 220xg for 10 min at 4°C and then resuspended in a 22% Percoll solution (GE Healthcare) with a PBS layer floated on top ...
-
bioRxiv - Molecular Biology 2024Quote: ... 140∼150 uL of 6∼7 mg/mL of each complex solution was injected into the superdex200 increase 10/300 (GE Healthcare) column ...
-
bioRxiv - Systems Biology 2024Quote: ... Digests were filtered through 100 μm mesh strainer (Falcon) and subjected to density gradient centrifugation using 40% and 70% Percol solutions (GE Healthcare).
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were cleaned with Sephadex G-50 fine medium (70g/L; GE Healthcare, Chicago, Illinois, USA), centrifuged through a 96-well filter plate (Phenix Research ...
-
bioRxiv - Genetics 2020Quote: The amplification reaction was performed in 0.2 ml tube puReTaq Ready-To-GoTM PCR beads (GE Healthcare) containing 2.5 U of lyophilized PuReTaq ...
-
bioRxiv - Microbiology 2021Quote: ... and purified by using an illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, U.S.A). The linker was generated by annealing 100 μM of each oligonucleotides P2-FW (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were then purified using ExoStar (Illustra™ Exostar™ 1_Step, GE Healthcare Bio-Sciences Corp.). Final PCR products were sent to Macrogen Europe for sequencing using the primers SA (AACCTGGTTGATCCTGCCAGT ...
-
bioRxiv - Microbiology 2020Quote: ... (Frigerio et al., 2020): we used puReTaq Ready-To-Go PCR beads (GE Healthcare Life Sciences, Italy) according to manufacturer’s instructions in a 25 μL reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR plate was sealed with aluminum foil (Mircroplate Foil, 96 well, GE Healthcare, # 28-9758-16) and a temperature gradient of 37°C to 67°C was applied for 3 min using a PCR machine ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR product purification was done with streptavidin-sepharose high-performance beads (GE Healthcare Life Sciences, Piscataway, NJ), and co-denaturation of the biotinylated PCR products and sequencing primer (3.6 pmol/reaction) ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR products were fused in-frame behind GST on a pGex2T vector (GE Healthcare, Buckinghamshire, UK). 6xHis-tagged fragments were amplified from yeast genomic DNA using primers containing SfiI restriction sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR product purification was done with streptavidin-sepharose high-performance beads (GE Healthcare Life Sciences, Piscataway, NJ), and co-denaturation of the biotinylated PCR products and sequencing primer (3.6 pmol/reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were analyzed on 2% agarose gels and imaged using an Amersham Imager 680 (GE Healthcare).