Labshake search
Citations for GE Life Sciences :
351 - 400 of 1430 citations for N6 2 aminoethyl 9H purine 2 6 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: ... Peak fractions were diluted with 2 volumes of buffer H and loaded onto a 1-mL SP HP column (GE Healthcare) and washed with buffer C (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was supplemented with 4 mM CaCl2 and stirred for 2 h in 4°C with CaM-Sepharose beads (GE Healthcare), pre-equilibrated with binding buffer (50 mM Tris/HCl pH 7.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gel was washed with the wash buffer and the IF3-bound complexes were eluted by additional incubation of 2 h with the PreScission protease (GE Healthcare) (2 U/μl).
-
bioRxiv - Microbiology 2022Quote: ... or His-NTV-AviTag (80 µl at 2 mg/ml) were injected on a Superdex 200 increase 10/300 GL column (GE Healthcare), equilibrated at 4°C with a buffer containing 25 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... The obtained pellet was resuspended in 2 mL of washing buffer and loaded on top of a 28% (v/v) Percoll (GE Healthcare) continuous gradient with a 0% to 4% (w/v ...
-
bioRxiv - Immunology 2022Quote: SPR screening and affinity measurements of monoclonal Fabs binding to SARS-CoV-2 spike proteins were performed using a Biacore S200 instrument (Cytiva, formerly GE Healthcare) in HBS-EP+ 1X running buffer ...
-
bioRxiv - Biochemistry 2022Quote: Antibody binding to SARS-CoV-2 spike was assessed using SPR on a Biacore T-200 (Cytiva, MA, formerly GE Healthcare) with HBS buffer supplemented with 3 mM EDTA and 0.05% surfactant P-20 (HBS-EP+ ...
-
bioRxiv - Neuroscience 2020Quote: T1-weighted images providing high anatomical detail were acquired on 2 GE 3T Discovery 750× scanners (GE Healthcare, Waukesha, WI, USA) with an 8-channel phased array head coil (scanner 1 N=336 ...
-
bioRxiv - Microbiology 2020Quote: ... Aliquots were taken every 30 minutes for a period of 2 hours and quenched in 3ml of 5% trichloroacetic acid (TCA) on Whatman-glass fiber filters (GE healthcare) and washed 3 times with 1ml ethanol to dry the filter ...
-
bioRxiv - Neuroscience 2020Quote: Dynamic PET/CT imaging (2-3h) with arterial blood sampling was performed on Monkey 3 and Monkey 4 using a Discovery MI (GE Healthcare). Each animal had two baseline scans which were separated by one month for Monkey 3 and by one year for Monkey 4 ...
-
bioRxiv - Microbiology 2021Quote: ... Gels were dried and exposed on a phosphoscreen for 2-4 days and visualized using a Typhoon Imaging System (GE Healthcare). Bands were quantified using band densitometry using the ImageQuant software (GE Healthcare).
-
bioRxiv - Biochemistry 2021Quote: The binding affinities of full IgG antibodies to SARS-CoV-2 spike protein were determined using surface plasmon resonance (SPR) and a BIAcore T200 instrument (GE Healthcare) at 25°C ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 μl of freshly purified protein (concentration 1-2 mg/ml) was injected on a Superdex 75 300/10 GL column (GE Healthcare) at a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... mononuclear cells were isolated by density gradient centrifugation of PBS-diluted buffy coat/blood (1:2) over Ficoll-Paque Plus (GE Healthcare). The PBMC layer was carefully removed and washed 3 times with PBS.
-
bioRxiv - Cancer Biology 2022Quote: ... Blood was diluted 1:2 with 1× phosphate-buffered saline (PBS) and transferred to a 50 ml falcon tube with Ficoll-Paque PLUS (GE Healthcare) at a 1:2 ratio ...
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... 50-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 75 10/300 GL increase size-exclusion chromatography column (GE Healthcare) in 10 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... M was concentrated to 2 ml using Vivaspin20 columns (SartoriusStedimBiotec) and purified on a HiLoad 10/600 Superdex S200 column (GE Healthcare) in 50 mM NaH2PO4-Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... to a volume of 2 ml and applied to size exclusion chromatography (SEC; HiLoad 26/600 Superdex 200 pg, GE Healthcare), After SEC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplified fragments of the NP(412-500) or shorter fragments from pCAGGS-NP were cloned into pGEX-6P-2 (GE Healthcare). All sequences of the cloned or mutated DNA regions of the plasmids were validated by Sanger DNA sequencing.
-
bioRxiv - Immunology 2021Quote: One mg per sample of mouse anti-H-2 Kb/Db antibody (ATCC HB-51) was bound and cross-linked to Protein A beads (GE healthcare) using dimethyl pimelimidate (DMP ...
-
bioRxiv - Biochemistry 2021Quote: ... purified OxlT was mixed with purified 20D033-Fv at a 1:2 molar ratio at 4 °C overnight and purified using Superdex200 Increase 10/300 GL (GE healthcare) in 20 mM MES-KOH ...
-
bioRxiv - Physiology 2020Quote: ... and incubated lysate equivalent to 2 mg of protein with 50 μL Streptavidin Sepharose High-Performance beads (GE Healthcare, IL, USA) for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3D widefield datasets were acquired using a 100x 1.4NA Uplan S Apochromat objective on a DeltaVision 2 Ultra microscope equipped with 7-Color SSI module and sCMOS camera and controlled by Acquire Ultra acquisition software (GE Healthcare), computationally deconvolved using the enhanced ratio constrained iterative deconvolution algorithm ...
-
bioRxiv - Cell Biology 2020Quote: ... the corresponding cDNAs of mouse angulin-1 were amplified by PCR using KOD-Plus-Ver.2 DNA polymerase and subcloned into pGEX-6P-1 (GE Healthcare). To construct an expression vector for MBP-tagged N-ZO-1 (aa 1-862) ...
-
bioRxiv - Biochemistry 2020Quote: ... Nap1 containing fractions were concentrated to 2 mg/mL and loaded on a Superdex 200 10/300 GL gel-filtration column (GE Healthcare) pre-equilibrated with 25 mM HEPES pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... fluorescently labeled R18-HRSV or culture supernatants of HEp-2 were separated from excess R18 by a separation column (PD-10 Desalting Columns GE Healthcare). HRSV-R18 or culture supernatants of HEp-2 were incubated in suspension with A3.01 and HEp-2 cells at 4°C for 1 h to allow virus attachment ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified products were separated by electrophoresis on a 2% agarose gel and quantified by using Image Quant TL analysis software (GE Healthcare). Quantitative real-time PCR was performed on a TP-850 Real-Time PCR Detection System (TAKARA Bio ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length nsp1 was synthesized as a gene fragment from Integrated DNA technologies (IDT) and cloned into the EcoR1 restriction site of pGEX-6P-2 (GE healthcare) using in-fusion cloning (TakaraBio) ...
-
bioRxiv - Immunology 2020Quote: ... An equal volume of buffer (2 mM EDTA in PBS) and blood was mixed and carefully layered over 5ml Ficoll Hypaque solution (GE Healthcare). After centrifugation for 20 min at 900 g (with no break ...
-
bioRxiv - Immunology 2021Quote: The binding affinities of antibodies to SARS-CoV-2 spike protein were determined using surface plasmon resonance (SPR) and a BIAcore T200 instrument (GE Healthcare) at 25°C ...
-
bioRxiv - Immunology 2021Quote: ... and ACE2(HH:NN)-Fc constructs were captured on flow cell 2 of a Series S Protein A sensor chip (GE Healthcare – 29127555) to a density of 500 RU using a Biacore 8K instrument (GE Healthcare) ...
-
bioRxiv - Bioengineering 2021Quote: ... Sonications (10-ms bursts applied at 2 Hz for 100 s) were applied coincident with an injection of the MB ultrasound contrast agent Optison (GE Healthcare, Little Chalfont ...
-
bioRxiv - Cell Biology 2020Quote: ... and differentiation was induced in differentiation medium (DM) for hMB consisting of DMEM (Nacalai) with 2% horse serum (HS) (HyClone; GE Healthcare) and PS.
-
bioRxiv - Neuroscience 2023Quote: ... lysates were incubated with the primary antibody at 4°C for 2 h or overnight and then incubated with protein G- or protein A-Sepharose (GE Healthcare) for 2 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2, cells were changed with fresh media containing RMPI1640 (Thermo, 21870) supplemented with 0.2% Hyclone FBS (GE Healthcare, SH30070.03) 100 ng/mL Activin A (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... The ACE2 receptor or SARS-CoV-2 spike-specific antibodies (CR3022 or S309) were immobilized on the protein A sensor chip (GE Healthcare) at a ligand capture level of ∼100 RU ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM DTT) for 16 h before further purification by anion exchange chromatography on a HiTrap Q HP column (GE Healthcare), followed by size exclusion chromatography (SEC ...
-
bioRxiv - Cell Biology 2023Quote: ... were used at a dilution of 1:10,000 and the HRP-linked sheep F(ab’)2 fragment to mouse IgG (GE Healthcare, NA9310) was used as the secondary antibody at a 1:10,000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Finally membranes were again washed three times with TBST and submerged in SuperSignal West Pico chemiluminescent substrate for 2 min before visualizing through ImageQuant LAS 4000 chemiluminescent Image analyzer (GE Healthcare). We used a variety of inhibitors including Torin 1 (inh-tor1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were then incubated for 2-h at room temperature with rabbit HRP-linked IgG (GE Healthcare, Chicago, IL, USA), and a chemiluminescence detection reagent (SuperSignal™ West Pico PLUS Chemiluminescent Substrate ...
-
bioRxiv - Neuroscience 2023Quote: ... The PAGE gel was exposed to a phosphorimage screen for ∼2 hours and analyzed using a Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... F045 and TriHSB.2 constructs contain C-terminal 6xHis tags and were purified by passage over a HisTrapFF column (GE Healthcare), followed by size exclusion chromatography using a Superdex 200 increase 10/300 column (Cytiva) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein samples (100 μl at 2 mg/ml) were resolved using a Superdex 200 10/300 analytical gel filtration column (GE Healthcare) running at 0.5 ml/min at 25 °C in 10 mM K-HEPES pH 8.0 ...
-
bioRxiv - Biophysics 2024Quote: ... Samples were run for 2 h at 90 V and then scanned using a Typhoon FLA 9500 laser scanner (GE Healthcare) at a pixel size of 50 µm ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated with blocking solution (2.5 % FBS, 200 mM glycine, 0.1 % Triton X-100 in PBS or 2 % bovine serum albumin (GE Healthcare or Calbiochem), 0.01 % Tween 20 (National Diagnostics or Roth ...