Labshake search
Citations for GE Life Sciences :
1601 - 1650 of 2709 citations for Mouse Eukaryotic Translation Termination Factor 1 ETF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Proteins from the samples were purified by a modified trichloroacetic acid protein precipitation procedure (Clean-Up Kit; GE Healthcare, Munich, Germany), and gel-assisted proteolysis was carried out ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare). ImageJ was used for quantifications of the bands.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Cell Biology 2024Quote: ... blots incubated with HPR-conjugated secondary antibodies were developed using HRP substrate (EZ-ECL chemiluminescence detection kit for HRP, Geneflow Ltd.) followed by exposure on an ImageQuant chemiluminescent imaging system (GE Healthcare). For blots probed with fluorescent secondary antibodies ...
-
bioRxiv - Genetics 2024Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled V5 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Immunology 2024Quote: ... Detection was performed with the use of Pierce Fast Western Blot Kit in an Amersham Imager 600 (GE Healthcare Life Sciences)..
-
bioRxiv - Microbiology 2024Quote: Single Cononympha cells were collected using a Leica AM6000 micromanipulation system and subjected to whole genome amplification (WGA) using the illustra GenomiPhi V2 kit (GE Healthcare) as described previously [30] ...
-
bioRxiv - Microbiology 2020Quote: ... The nsp7 and nsp8 genes were cloned into pGEX-6P-1 vector (GE Healthcare) with an N-terminal GST tag followed by a PreScission protease site ...
-
bioRxiv - Biochemistry 2020Quote: ... The eluate was then loaded onto 1 mL HiTrap Heparin HP column (GE Healthcare) and washed with 10 CVs Heparin Buffer (50 mM NaHEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... backside blotted for 5-10 s with Whatman filter paper grade 1 (GE Healthcare) and vitrified in liquid ethane using a home-made manual plunger.
-
bioRxiv - Neuroscience 2020Quote: ... Tagmented fragments were purified with 1 volume of SPRI beads (1mL SeraMag GE Healthcare, 65152105050250 beads in 100mL of PEG8000 20% ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Flow-Through was loaded in a 1 ml RESOURCE S column (GE Healthcare), and eluted through a 25 ml gradient (100 mM-1 M NaCl) ...
-
bioRxiv - Cell Biology 2019Quote: GST-tagged mammalian ATG8 fusion proteins were cloned into pGEX-4T-1 (GE Healthcare) and expressed in Escherichia coli BL21 (DE3 ...
-
Transcription factor LSF facilitiates lysine methylation of α-tubulin by microtubule-associated SET8bioRxiv - Biochemistry 2019Quote: ... SET8 and α-tubulin cDNAs were cloned into the pGEX-5X-1 (GE Healthcare) or pMalC4X (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein expression was induced by adding (isopropyl β-D-1-thiogalactopyranoside, IPTG; GE Healthcare) to a final concentration of 0.3 mM ...
-
bioRxiv - Biochemistry 2019Quote: ... and coverslips were incubated with 1:100 primary anti-bromodeoxyuridine antibody (RPN202; GE Healthcare) in the dark for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT) and purified by anion exchange chromatography (MonoQ 5/50GL, GE Healthcare) on an AKTA pure chromatography system (GE Healthcare) ...
-
bioRxiv - Genetics 2020Quote: ... an additional step of purification with a 1 ml HiTrap Talon column (GE Healthcare) was used in between HiTrap Heparin HP (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... and IgG anti-rabbit horseradish peroxidase–conjugated secondary antibody (1:10,000; GE Healthcare UK). For whole cerebellum and cerebellar slices ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM DTT) and loaded onto a MonoQ 5/50 GL column (GE Healthcare) equilibrated with MonoQ buffer A containing 50 mM NaCl ...
-
bioRxiv - Biophysics 2021Quote: ... lysate was purified on a 1 ml Strep Trap HP (GE Healthcare, Chicago, IL) using the Äkta pure purification system (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: ... The chip was deactivated by 1 M Ethanolamine hydrochloride-NaOH (GE Healthcare Life Sciences) at a flow rate of 10 μL/min for 420 s ...
-
bioRxiv - Biophysics 2021Quote: ... was applied to a Superdex 200 (30 x 1 cm) analytical column (GE Healthcare) equilibrated in 150 mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: Affinity purification used a 1 mL-HisTrap FF crude column (GE Healthcare, now Cytiva) at a flow rate of 1 mL/min ...
-
bioRxiv - Plant Biology 2020Quote: ... we used a peroxidase-labeled anti-rabbit antibody (NIF824, GE Healthcare; 1:5000 dilution). Immunodetection was performed by incubating the membranes in the Western BLoT Quant HRP Substrate (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... a 1:10000 dilution of HRP-conjugated donkey anti-rabbit antibody (GE Healthcare, NA934), and ECL detection reagent ...
-
bioRxiv - Plant Biology 2020Quote: ... extracts were filtered using Whatman filter paper #1 (GE Healthcare UK Limited, Buckinghamshire, UK). Then the filtrate was concentrated at 50°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and HRP conjugated anti-rabbit IgG (Cat#NA934-1ML, GE Healthcare, 1:50,000 dilution). As a loading control ...
-
bioRxiv - Microbiology 2021Quote: ... ceg3 and ANT1 were inserted into pZLQ-Flag and pGEX-6p-1 (GE Healthcare), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... the protein was concentrated to 1 mg/ml using a vivaspin 20 (GE Healthcare) and store at −80 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was loaded onto 1 ml Ni-NTA FF-HisTrap columns (GE Healthcare) for affinity purification via the hexahistidine tag ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by the corresponding Horseradish Peroxidase (HRP) conjugated secondary antibodies (1:5000, GE Healthcare) and visualized using the ECL Plus Western Blotting detection system (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... MBNL1 (amino acids 1-269 of MBNL140) was obtained in pGEX-6P1 (GE Healthcare). Plasmids were transformed into E ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT and applied to a prewetted nitrocellulose membrane (GE Healthcare, 0.2 µm) under vacuum using a Dot Blot Apparatus (SCIE-PLAS) ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of total RNA was quantified using a nanodrop spectrophotometer Nanovue (GE Healthcare) and used for making cDNA using Verso cDNA synthesis kit (Thermo Fischer Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were immobilized on a HiTrap Talon crude 1 ml column (GE Healthcare), equilibrated with buffer A (50□mM NaH2PO4 (pH 8) ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAVs were purified with 1-ml HiTrap heparin high-performance columns (GE Healthcare) as described27 ...
-
bioRxiv - Microbiology 2021Quote: ... membranes were incubated in 1:10000 diluted anti-rabbit IgG (NA934-1ML; GE Healthcare) in TBS-T for one hour at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 ml of NHS-Activated Sepharose 4 Fast Flow beads (GE Healthcare Life Sciences) was washed with 10-15 column-volumes of 1 mM HCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNAs encoding human NGN3 protein fragments were sub-cloned into pGEX4T-1 (GE Healthcare), expressed in Escherichia coli ...
-
bioRxiv - Biophysics 2019Quote: ... Purified σ70 was incubated with Cy5 maleimide mono-reactive dye (1 mM, GE Healthcare) in the storage buffer (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... cleared and concentrated to 1 ml in a VIVASPIN™ 20 column (GE Healthcare). The concentration of GDF15 was measured using an ELISA assay for Human GDF-15 DuoSet (R&D systems ...