Labshake search
Citations for GE Life Sciences :
1251 - 1300 of 2467 citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... RNA (5 μg) was used to synthesize the first-strand complementary DNA (cDNA) using the First-Strand cDNA synthesis kit (GE Healthcare) with a pd(N)6 primer following the manufacturer’s indications ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled CLB3 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Neuroscience 2023Quote: Proteins from the samples were purified by a modified trichloroacetic acid protein precipitation procedure (Clean-Up Kit; GE Healthcare, Munich, Germany), and gel-assisted proteolysis was carried out ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... blots incubated with HPR-conjugated secondary antibodies were developed using HRP substrate (EZ-ECL chemiluminescence detection kit for HRP, Geneflow Ltd.) followed by exposure on an ImageQuant chemiluminescent imaging system (GE Healthcare). For blots probed with fluorescent secondary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... An Fc capture chip was produced by amine coupling of anti-mouse IgG antibody to a CM5 chip using a commercial Fc Capture Kit (GE Healthcare). First ...
-
bioRxiv - Immunology 2024Quote: ... Detection was performed with the use of Pierce Fast Western Blot Kit in an Amersham Imager 600 (GE Healthcare Life Sciences)..
-
bioRxiv - Genetics 2024Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled V5 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Microbiology 2020Quote: ... The nsp7 and nsp8 genes were cloned into pGEX-6P-1 vector (GE Healthcare) with an N-terminal GST tag followed by a PreScission protease site ...
-
bioRxiv - Biochemistry 2020Quote: ... The eluate was then loaded onto 1 mL HiTrap Heparin HP column (GE Healthcare) and washed with 10 CVs Heparin Buffer (50 mM NaHEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... backside blotted for 5-10 s with Whatman filter paper grade 1 (GE Healthcare) and vitrified in liquid ethane using a home-made manual plunger.
-
bioRxiv - Neuroscience 2020Quote: ... Tagmented fragments were purified with 1 volume of SPRI beads (1mL SeraMag GE Healthcare, 65152105050250 beads in 100mL of PEG8000 20% ...
-
bioRxiv - Neuroscience 2021Quote: ... placed in 5% milk PBST plus 1:2500 mouse specific HRP antibodies (GE Healthcare) at room temperature for 4 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse or anti-rat secondary antibodies (1:4000 in blocking buffer, GE Healthcare) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Flow-Through was loaded in a 1 ml RESOURCE S column (GE Healthcare), and eluted through a 25 ml gradient (100 mM-1 M NaCl) ...
-
bioRxiv - Cell Biology 2019Quote: ... the samples were incubated with biotinylated sheep anti-mouse (1:200, RPN1001V, GE Healthcare) followed by peroxidase labeled streptavidin (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: GST-tagged mammalian ATG8 fusion proteins were cloned into pGEX-4T-1 (GE Healthcare) and expressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... and HRP-linked Sheep Anti-Mouse IgG (1:2000; GE Healthcare Life Sciences, NAG31V). For the analysis of p65 NFκB localisation and phosphorylation ...
-
bioRxiv - Molecular Biology 2019Quote: ... and α-mouse HRP-linked F(ab’)2 (GE Life Sciences NA9310; 1:5000). Blots were visualized by chemiluminescence with the SuperSignal West Femto kit (Pierce ...
-
Transcription factor LSF facilitiates lysine methylation of α-tubulin by microtubule-associated SET8bioRxiv - Biochemistry 2019Quote: ... SET8 and α-tubulin cDNAs were cloned into the pGEX-5X-1 (GE Healthcare) or pMalC4X (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein expression was induced by adding (isopropyl β-D-1-thiogalactopyranoside, IPTG; GE Healthcare) to a final concentration of 0.3 mM ...
-
bioRxiv - Biochemistry 2019Quote: ... and coverslips were incubated with 1:100 primary anti-bromodeoxyuridine antibody (RPN202; GE Healthcare) in the dark for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT) and purified by anion exchange chromatography (MonoQ 5/50GL, GE Healthcare) on an AKTA pure chromatography system (GE Healthcare) ...
-
bioRxiv - Genetics 2019Quote: ... or HRP-conjugated anti-mouse IgG (GE Healthcare NA931V, Lot 9648752; 1:10000 dilution). Signals were produced by enhanced chemiluminescence (ECL ...
-
bioRxiv - Genetics 2020Quote: ... an additional step of purification with a 1 ml HiTrap Talon column (GE Healthcare) was used in between HiTrap Heparin HP (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... and IgG anti-rabbit horseradish peroxidase–conjugated secondary antibody (1:10,000; GE Healthcare UK). For whole cerebellum and cerebellar slices ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM DTT) and loaded onto a MonoQ 5/50 GL column (GE Healthcare) equilibrated with MonoQ buffer A containing 50 mM NaCl ...
-
bioRxiv - Biophysics 2021Quote: ... lysate was purified on a 1 ml Strep Trap HP (GE Healthcare, Chicago, IL) using the Äkta pure purification system (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: ... The chip was deactivated by 1 M Ethanolamine hydrochloride-NaOH (GE Healthcare Life Sciences) at a flow rate of 10 μL/min for 420 s ...
-
bioRxiv - Biophysics 2021Quote: ... was applied to a Superdex 200 (30 x 1 cm) analytical column (GE Healthcare) equilibrated in 150 mM NaCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... horseradish peroxidase (HRP)-conjugated anti-mouse antibody (NA931, GE Healthcare Life Sciences, 1:10,000) or HRP-conjugated anti-rabbit antibody (NA934V ...
-
bioRxiv - Biochemistry 2021Quote: Affinity purification used a 1 mL-HisTrap FF crude column (GE Healthcare, now Cytiva) at a flow rate of 1 mL/min ...
-
bioRxiv - Plant Biology 2020Quote: ... we used a peroxidase-labeled anti-rabbit antibody (NIF824, GE Healthcare; 1:5000 dilution). Immunodetection was performed by incubating the membranes in the Western BLoT Quant HRP Substrate (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... a 1:10000 dilution of HRP-conjugated donkey anti-rabbit antibody (GE Healthcare, NA934), and ECL detection reagent ...
-
bioRxiv - Plant Biology 2020Quote: ... extracts were filtered using Whatman filter paper #1 (GE Healthcare UK Limited, Buckinghamshire, UK). Then the filtrate was concentrated at 50°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and HRP conjugated anti-rabbit IgG (Cat#NA934-1ML, GE Healthcare, 1:50,000 dilution). As a loading control ...
-
bioRxiv - Microbiology 2021Quote: ... ceg3 and ANT1 were inserted into pZLQ-Flag and pGEX-6p-1 (GE Healthcare), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... membrane was finally incubated with HRP-conjugated anti-mouse IgG (1:5000; GE Healthcare) overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... the protein was concentrated to 1 mg/ml using a vivaspin 20 (GE Healthcare) and store at −80 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was loaded onto 1 ml Ni-NTA FF-HisTrap columns (GE Healthcare) for affinity purification via the hexahistidine tag ...
-
bioRxiv - Biophysics 2020Quote: ... and a secondary anti-mouse IgG HRP-conjugated antibody (1:1000, #NA931, GE Healthcare). The soluble fraction was found to contain more AβM(E22G)-mCherry than the insoluble fraction (Supplementary Figure 5. ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by the corresponding Horseradish Peroxidase (HRP) conjugated secondary antibodies (1:5000, GE Healthcare) and visualized using the ECL Plus Western Blotting detection system (GE Healthcare).
-
bioRxiv - Cell Biology 2021Quote: ... followed by anti-rabbit and mouse antibodies coupled to HRP (1:2000, GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... MBNL1 (amino acids 1-269 of MBNL140) was obtained in pGEX-6P1 (GE Healthcare). Plasmids were transformed into E ...