Labshake search
Citations for Millipore Sigma :
451 - 500 of 2403 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Oligodeoxynucleotide primers were purchased from Sigma-Aldrich Japan (Tokyo ...
-
bioRxiv - Cancer Biology 2023Quote: ... All primers were synthesized by Sigma-Aldrich [sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... All primers were purchased from Sigma-Aldrich and used at a final concentration of 0.5 µM ...
-
bioRxiv - Microbiology 2024Quote: ... DNA primers were purchased from Sigma-Aldrich. Synthetic genes of ctg1_5739 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 3 pmol of each primer (Sigma-Aldrich) and 2 μl of extracted DNA ...
-
bioRxiv - Microbiology 2024Quote: ... All primers were obtained from Sigma Aldrich. Supplementary Table S4 lists all primers used in this study.
-
bioRxiv - Cancer Biology 2024Quote: ... Control primers (EZ-ChIP 22–004; Millipore) for the human GAPDH and RPL30 were used as an internal and positive control ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Desalted primers were purchased from Sigma-Aldrich. The DNA fragments were purified using the Monarch PCR & DNA Cleanup Kit (NEB) ...
-
bioRxiv - Microbiology 2020Quote: Standard and previously described protocols were used for PCR amplification (a full list of PCR primers is provided in Table S2; all of them were obtained from Eurofins Genomics, Ebersberg, Germany or Sigma-Aldrich, St. Louis, MO, USA), bacterial transformation (E ...
-
bioRxiv - Bioengineering 2020Quote: ... 1:200 dilution Phosphatase Inhibitor Cocktail Set III (EMD Millipore # 524627). Lysate were collected and centrifuged at 4°C for 10 min at 15,000×g ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% Triton-X100) containing protease inhibitor Cocktail Set III (Millipore #539134). Homogenates were kept for 30 min on ice and then centrifuged at 8000xg for 15 min at 4°C to remove cell debris ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 mM ZnCl2) containing protease Inhibitor Cocktail Set III (Millipore #539134). Lysates were clarified by centrifugation at 8000×g for 15 min ...
-
bioRxiv - Immunology 2020Quote: ... cells were crushed using a Dounce tissue grinder set (Sigma-Aldrich) of 2ml ...
-
bioRxiv - Neuroscience 2019Quote: ... 200 μM Na3VO4 and protease inhibitor (Cocktail inhibitor set I; Millipore) (20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and phosphatase inhibitor cocktail set II (Millipore Sigma, 1:100 dilution). For each sample ...
-
bioRxiv - Physiology 2024Quote: ... proteinase inhibitor cocktail set III (Millipore, 535140-1mL, diluted 1:100) and phosphatase inhibitor cocktail set II (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... and phosphatase inhibitor cocktail set II (524625, Millipore, Massachusetts, United States) and III (P0044 ...
-
bioRxiv - Genetics 2024Quote: ... CpGenome™ Human Methylated & Non-Methylated DNA standard set (Sigma#S8001M) was used to prepare a set of methylation standards (0% ...
-
bioRxiv - Biochemistry 2023Quote: ... Affinity purified FH-Ago2 bound with miRNA (most population bound with miR-122 due to its overexpression) was eluted from anti-FLAG beads by competing with 3X FLAG peptide (Sigma) as per the manufacturer’s protocol in a purification buffer (30mM HEPES pH 7.4 ...
-
bioRxiv - Genomics 2019Quote: ... 40 nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 µL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma). Preparation of sort plates and all downstream pipetting steps were performed on a Biomek i7 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... 20 2n nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 μL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma). Preparation of sort plates and all downstream pipetting steps were performed on a Biomek i7 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Genomics 2021Quote: ... 20 nuclei per sample were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 µL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma)) ...
-
bioRxiv - Genomics 2021Quote: ... to sort four wells containing 0 nuclei per well and four wells containing 80 nuclei per well into one 96-well plate (total of 768 wells) containing 10.5 µL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 40 nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 µL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 μL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma). Preparation of sort plates and all downstream pipetting steps were performed on a Biomek i7 Automated Workstation (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... 20 nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 μL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma)) ...
-
bioRxiv - Genomics 2019Quote: ... 20 nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 µL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma), PMID ...
-
bioRxiv - Genetics 2021Quote: ... 20 nuclei were sorted per well into eight 96-well plates (total of 768 wells) containing 10.5 µL EB (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma))90 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Cre reverse primer 5’-GGT TTC CCG CAG AAC CTG AA-3’ (both primers were purchased from Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2023Quote: ... 20 nuclei per sample were sorted per well into eight 96-well plates (total of 768 wells) in 10.5 μL of Elution Buffer (25 pmol primer i7, 25 pmol primer i5, 200 ng BSA (Sigma) using a Sony SH800 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1h at RT, blocked for 1h at RT in blocking solution (0.3% Triton X-100, 0.2% BSA (A4503, Sigma), and 5% goat serum (005-000-121 ...
-
bioRxiv - Immunology 2022Quote: ... and fixed in RT methanol (Sigma-Aldrich) for 2 minutes prior to PAS staining according to manufacturer’s protocol (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... reverse transcribed with AMV RT (Sigma 10109118001), and then cDNA were quantified in multiplex TaqMan qPCR reactions using commercially available probe sets (Thermo Fisher 4453320 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1U ThermaStop-RT (Sigma-Aldrich) per 50U SSIII to increases RT-PCR specificity ...
-
bioRxiv - Molecular Biology 2020Quote: ... for NdeI (forward primer) and NotI (reverse primer) were included so that the entire ORF could be directly cloned into the pET23a (Novagen) vector ...
-
bioRxiv - Microbiology 2021Quote: ... Lak candidate primers with amplicons 114-221 bp were designed in Primer-BLAST51 and synthesised by Sigma-Aldrich (MO, USA), along with Prevotella primers ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μL 1 μM primer (equal mix of Forward and Reverse primers; Table S2) and 5 μL 2x SYBR Green master mix (Sigma) in a 384-well plate using a Roche LightCycler 480 with the following parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 minutes at RT and permeabilized for 15 minutes at RT with 0.2% Triton 100 X buffer (Sigma). Calu-3 cells were fixed with 4% PFA for 20 minutes at RT and permeabilized for 15 minutes at RT with 0.2% Triton 100X buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The primers were obtained from Sigma-Aldrich (UK).
-
bioRxiv - Cell Biology 2020Quote: ... E@sy Oligo primers (Millipore-Sigma, Burlington, MA) or TaqMan Assays (Life Technology ...
-
bioRxiv - Microbiology 2019Quote: ... The forward and reverse primers (Sigma-Aldrich®) were 5’GAAGATGTCAACCTAGGGAGC3’ and 5’TGGCGAATTCTTCTTTAAGC3’ respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... All other primers were obtained from Sigma-Aldrich. The reference gene used was b-actin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The primers used (by Sigma-Aldrich, ON, Canada) for amplification are shown in S1 Table ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene-specific primers were obtained from Sigma Aldrich. Either Hgprt or Gapdh was used as the normalizing control and quantification was done by the comparative Ct method.
-
bioRxiv - Biophysics 2020Quote: ... Primers were synthetized by Sigma-Aldrich (Table 1).
-
bioRxiv - Biochemistry 2020Quote: ... primers and oligonucleotides were purchased from Sigma Aldrich. Poly clonal and monoclonal antibodies against topo I were generated in the laboratory ...
-
bioRxiv - Neuroscience 2021Quote: ... Forward and reverse primers were ordered from Sigma and used at a concentration of 100 nM each ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sequences were synthesized by Sigma-Aldrich, and the sequences are gParacoccin forward (5’-GGCGCGCCATGGCCTTCGAAAATCAG-3’ ...
-
bioRxiv - Physiology 2021Quote: ... All primers were obtained from Sigma (Table 1). All experiments were performed in three technical replicates ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 0.3 μM of each primer (Sigma-Aldrich Inc.), 1.5U Taq polymerase (New England BioLabs® Inc. ...