Labshake search
Citations for Millipore Sigma :
201 - 250 of 3692 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR was performed for the amplification of cDNAs using the appropriate primers (Sigma-Aldrich, see Table S2) and the GoTaq® qPCR Master Mix (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: qPCR (q-PCR) primers were designed using Universal probe library Assay Design Center and were purchased from Sigma. Transcriptor High Fidelity cDNA Synthesis Kit (Roche ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR analysis was performed with PerfeCTa SYBR Green Fastmix (Quantabio) using the following primers from Sigma-Aldrich: S1pr1 (5’-AGCTTTTCCTTGGCTGGAGAG ...
-
bioRxiv - Cancer Biology 2022Quote: The integrated gRNAs were sequenced by the following primers using the Expand High Fidelity PCR system (Sigma-Aldrich): GeCKO 1717F 5′-GAGGGCCTATTTCCCATGAT-3′ and GeCKO 3913R 5′- CGGTGCCACTTTTTCAAGTT -3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the pPB_EF1_MCS-EGFP_IRES_Puro as a PCR template and utilising primers with the respective knockin-overhangs (ordered from Sigma-Aldrich). Gel-extracted PCR products (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: DNA primers (Sigma) were radiolabeled at the 5’-end with 32P using the manufacturer recommended protocol for T4 PNK (New England Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers (Sigma-Aldrich) for qRT-PCR were intron-spanning to avoid amplification of non-digested genomic DNA fragments and were designed by online Universal ProbeLibrary Assay Design Center (Roche) ...
-
bioRxiv - Zoology 2021Quote: ... Primers (Sigma Aldrich) used to amplify D2/D3LSU segment of all three species ...
-
bioRxiv - Cell Biology 2022Quote: ... mutagenic primers (Sigma) were created for the desired mutations ...
-
bioRxiv - Cell Biology 2019Quote: ... mutagenic primers (Sigma) were created for the desired mutations ...
-
bioRxiv - Microbiology 2019Quote: ... Primers (Sigma-Aldrich) were as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... and primers (Sigma) listed in Supplemental Table S1 ...
-
bioRxiv - Genomics 2022Quote: ... Oligonucleotide primers (Sigma) are listed in Table S9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primer sequences (Sigma) are listed in Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primers (Sigma Aldrich) and probes (MWG ...
-
bioRxiv - Developmental Biology 2023Quote: Primers (Sigma-Aldrich) were designed to amplify exon–exon junctions using PrimerBlast (NIH ...
-
bioRxiv - Genomics 2023Quote: ... qPCR primers (Sigma) were designed to amplify 75-200bp amplicons and were checked for specificity using Primer-BLAST (ncbi.nlm.nih.gov) ...
-
bioRxiv - Cancer Biology 2021Quote: ... solutions of 89Zr-labeled TDM1 (4 μCi/μg) were prepared in PBS (pH 7.5) containing 1% w/v human serum albumin (HSA, Sigma) and 0.1% w/v sodium azide (NaN3 ...
-
bioRxiv - Neuroscience 2021Quote: After extensive washes in PB and 0.05 M TBS sections were blocked in 1% HSA in TBS and 0,03% Triton X.100 and 50 ug/ml digitonin (D141-100MG, Sigma). Then ...
-
bioRxiv - Physiology 2021Quote: Total RNA was extracted from gastrocnemius muscles from wild-type and HSA-NRTN muscles using TRI reagent (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... pH = 7.6) containing 0.01% Triton X-100 (TBS-T) and then blocked with 2% human serum albumin (HSA; Sigma-Aldrich) and 10% NGS in TBS-T for 30 min ...
-
bioRxiv - Neuroscience 2019Quote: After extensive washes in PB and 0.05 M Tris-buffered saline (pH 7.4; TBS) sections were blocked in 1 % human serum albumin (HSA; Sigma-Aldrich) in TBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were extensively washed in 0.1M PB and TBS and blocked in 1% human serum albumin (HSA; Sigma-Aldrich) solution for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Phosphate buffered saline (PBS) containing 0.12% of DMSO and 4% of human serum albumin (HSA) (Sigma-Aldrich, MO, USA) was used as the negative control and incubation buffer ...
-
bioRxiv - Microbiology 2019Quote: ... RT-PCR was performed on 100 ng of cDNA in triplicate using SYBR Green Jumpstart Taq readymix (Sigma). Primers RMC379/380 (16S internal) ...
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... The cDNA samples generated with RT PCR were then used for performing qPCR using SYBR Green I (Sigma) and Platinum Taq polymerase (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: Digoxygenin (DIG)-labeled probes were produced with the SuperScriptTM III One-Step RT-PCR kit (Sigma 12574-026) using specific primers for the Bgl-FaNaC transcript (Forward ...
-
bioRxiv - Immunology 2022Quote: ... mature miR-31 was quantified using MystiCq® microRNA qPCR Assay (Sigma, MIRRM00-100RXN) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... miR-146a loaded MLNPs or empty MLNPs were lysed using 1% TritonX-100 (Sigma) and diluted in a working solution ...
-
bioRxiv - Cell Biology 2020Quote: ... The primers used for qPCR were Kicq predesigned primers (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2024Quote: ... predesigned primers KiCqStart® SYBR® Green Primers (Sigma-Aldrich, # KSPQ12012) were used for gene expression analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... All primers used for qPCR were Kicq pre-designed primers (Sigma).
-
bioRxiv - Genetics 2019Quote: ... 150 μM ascorbic acid (Sigma), 50 mM β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... 150 µl 1M MgCl2 (Sigma), 49.25 ml nuclease-free H2O ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl (Sigma Aldrich), 30 mM HEPES (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (1:150, Millipore, # MAB1398Z), CD13 (0.8µg / ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 µl MEA (Sigma 30070) 1M (50 mM) ...
-
bioRxiv - Immunology 2022Quote: ... 150 mM NaCl (Sigma-Aldrich), 1 mM EGTA (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... formaldehyde (Sigma-Aldrich, 150 μM), mitomycin C (MMC ...
-
bioRxiv - Genomics 2019Quote: ... 150 mM NaCl (Sigma, S5150); 1% IGEPAL CA-630 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 150 mM NaCl (Sigma-Aldrich), 5 mM iodoacetamide (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... or thiourea (150 mM; Sigma). Cultures were incubated at 37°C with shaking and aliquots were removed at t(0 ...
-
bioRxiv - Cell Biology 2020Quote: ... 150 mM NaCl (Sigma, S9888); 0.1% sodium dodecyl sulphate (SDS ...
-
bioRxiv - Cancer Biology 2021Quote: ... S9.6 (Sigma MABE1095; 1:150), or NCL (Novus NBP2-44612-0.02mg ...
-
bioRxiv - Cell Biology 2021Quote: ... ~150 μL 3-aminopropyltrimethoxylsilane (Sigma) was added onto the NaOH treated glass bottom from the previous step for 5 min ...
-
bioRxiv - Physiology 2022Quote: ... 150 mM NaCl (Sigma-Aldrich), 1% Triton X-100 (Fluka) ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... 150 mM KCl (Sigma, P9541), 5 mM MgCl2 (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 mM sodium chloride (Sigma)) for 1 hr at RT with gentle rocking ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 mM sodium chloride (Sigma)) for 1 hr at room temperature (RT ...
-
bioRxiv - Immunology 2023Quote: ... 150 mM NaCl (Sigma-Aldrich), 0.5% sodium deoxycholate (Sigma-Aldrich) ...