Labshake search
Citations for Millipore Sigma :
451 - 500 of 4429 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... transferred to a 96-well filter microtiter plate (Millipore), and destained in 50% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... Plates were developed using O-phenylenediamine dihydrochloride (OPD, Sigma) and analyzed at 492 nm with a noise correction at 620 nm ...
-
bioRxiv - Immunology 2023Quote: ... Plates were developed with 4-nitrophenyl phosphate (Sigma-Aldrich) and stopped with sodium hydroxide ...
-
bioRxiv - Microbiology 2023Quote: ... Nunc® MaxiSorp™ 384 well plates (Sigma-Aldrich) were coated overnight with 10 ng/well rabbit anti-mouse IgA (Novus Biologicals ...
-
bioRxiv - Immunology 2024Quote: ... ELISpot plates were developed with BCIP/NBT (Sigma, B1911).
-
bioRxiv - Immunology 2023Quote: ... The plates were sealed with breathable membrane (Millipore Sigma) to prevent condensation overtime and minimize evaporation ...
-
bioRxiv - Immunology 2023Quote: ... Plates were washed and developed using TMB substrate (Sigma), stopped using sulphuric acid and read at 450 nm ...
-
Somatostatin interneurons control the timing of developmental desynchronization in cortical networksbioRxiv - Neuroscience 2023Quote: ... or 10 15-cm diameter plates (Sigma-Aldrich, 408727), depending on whether we used linear or branched polyethylenimine (PEI ...
-
bioRxiv - Plant Biology 2024Quote: The liquid of MeJA (500 nmol/plate) (Sigma-Aldrich) was applied to a filter paper pad left in the cap of an Eppendorf tube (1.5 mL ...
-
bioRxiv - Neuroscience 2024Quote: ... or 10 15-cm diameter plates (Sigma-Aldrich #408727), depending on whether we used linear or branched polyethylenimine (PEI ...
-
bioRxiv - Developmental Biology 2024Quote: ... plates in DMEM high-glucose medium (Sigma-Aldrich, D5671) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... All plates were developed with phosphatase substrate (Sigma-Aldrich) diluted in alkaline phosphatase staining buffer (pH 9.8) ...
-
bioRxiv - Microbiology 2024Quote: ... plates were stained with 0.05% neutral red (Sigma-Aldrich) and plaques were counted to calculate virus titers expressed as PFU/ml.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and real-time quantitative reverse transcriptase PCR analysis (qRT-PCR) was performed using SYBR Green® reagent (Sigma Aldrich) as previously described (46) ...
-
bioRxiv - Genetics 2022Quote: ... Real-time PCRs were done in a 10 μl volume using the Absolute quantitative PCR SYBR Green mix (Sigma) in a 96-well plate ...
-
bioRxiv - Genetics 2019Quote: ... 50 uL of PCR product of each sample was purified with SpinPrep PCR Clean-Up Kit (EMD Millipore Corp) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... the tagmented DNA was amplified by PCR using the KAPA2G Robust PCR kit (Sigma-Aldrich, St. Louis, MO, USA) using the GC buffer along with 0.2 μM of each custom P5 and P7 indexing primers (File S1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Template plasmid was digested using DpnI and the PCR products were purified using a PCR purification kit (Sigma-Aldrich). Subsequently ...
-
bioRxiv - Plant Biology 2021Quote: Root gravitropic response of 50 five-days old seedlings was measured by ImageJ software after transferring seedlings to BM plates (no brefeldin A, BFA) or agar plates containing 10 μM BFA (Sigma catalogue no: B7651) and rotating the plates vertically by 135° for 24h (Richter et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Of this 200 μL and left to form a biofilm in 48 wells plates (Corning® Costar® TC-Treated Multiple Well Plates from Sigma-Aldrich) or chamber slides (Lab-Tek® Chamber SlideTM System ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR conditions were set up to amplify only the short 670 bp product using REDExtract-N-Amp PCR ReadyMix (Sigma). PCR conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Neuroscience 2022Quote: Genotyping for the R1.40 transgene locus was done with the recommended PCR primers using the PCR Ready Mix kit (E3004; Sigma-Aldrich). The sequences of the genotyping primers were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... amplified by PCR with Phusion U Hot Start PCR MasterMix (Thermo-Fischer Scientific) in presence of 0.5 mM betaine (Sigma-Aldrich) using universal bacterial primers (27F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT ...
-
bioRxiv - Genetics 2021Quote: ... Purification of genomic Polymerase Chain Reaction (PCR) amplified DNA was performed with the GenElute PCR Clean-Up kit (Sigma-Aldrich) or the GeneJET PCR Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Gene expression was measured by quantitative RT-PCR and normalized to β-actin8,48 The SYBR Green quantitative RT-PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Genomics 2020Quote: ... The painting probes were generated from the DOP-PCR amplified samples by a secondary DOP-PCR incorporation of biotin-dUTP and digoxigenin-dUTP (Sigma) [25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18bp of the reverse complement of the beginning of the DNA tag sequences was added to the 5’ of the reverse primer so that the CRM can be combined with the DNA tag in equal amount using overlap PCR (Xiong et al., 2006) using Expand High Fidelity PLUS PCR (Sigma). The resulting fragment was run on 2% agarose 1x TAE gel ...
-
bioRxiv - Microbiology 2020Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified 1,297 RT-PCR products were digested with MluI (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR products were cloned into pET21a (Novagen) using InFusion cloning technology ...
-
bioRxiv - Genomics 2020Quote: ... 1M betaine (PCR Reagent grade, Sigma-Aldrich, USA) and 0.667μM of each random primer (5’GTGAGTGATGGTTGAGGTAGTGTGGAGNNNNNTTT 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 0.5μM PCR primers (Sigma-Aldrich; S4 Table) in a Real-Time PCR Detection System CFX96 (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... and Expand high-fidelity PCR system (Sigma-Aldrich). RT-PCR products were purified on 0.7% agarose gel and subjected to Sanger sequencing (ACGT) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer pairs for PCR were from Sigma (eGFP) and Invitrogen (GAPDH) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of BioStabII PCR Enhancer (Sigma). For each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequent PCR was performed with primers (Sigma-Aldrich) based on the Icelandic rock ptarmigan genome and Taq DNA polymerase (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were subjected to 0.7% agarose gel analysis and the gel-purified PCR fragments were subjected to sanger sequencing (ACGT) ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR system (Sigma Aldrich). Amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were first cloned in pET22b (Novagen; containing the N-terminal pelB sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification with PCR Cleanup kit (Sigma-Aldrich), nucleic acids were eluted in 100 μL of elution buffer (5 mM Tris-HCl pH 8.5 ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were separated on a 0.7% agarose gel ...
-
Anatomical meniscus construct with zone specific biochemical composition and structural organizationbioRxiv - Bioengineering 2019Quote: ... SybrGreen Quantitative RT-PCR kit (Sigma Aldrich, Germany) was used with Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... using Expand Long Template PCR System (Sigma Aldrich). PCR primers were designed using the MEIS1 promoter as a viewpoint and included Truseq adapters ...
-
A pancreas specific Ptf1a-driven Cre mouse line causes paternally transmitted germline recombinationbioRxiv - Genetics 2020Quote: ... supplemented with 10ul PCR grade Proteinase K (Sigma) at 55°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Nested PCR primers were ordered from Sigma-Aldrich’s custom oligo service ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). Amplified DNA products ...
-
bioRxiv - Microbiology 2022Quote: The KAPA Taq PCR Kit (Sigma-Aldrich KR0352_S) was used to amplify the reads from a cDNA mixture of uninfected samples and 1 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR product was cloned into vector pET28a (Novagen) and the obtained construct was used to transform E ...