Labshake search
Citations for Millipore Sigma :
101 - 150 of 1752 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using 10 μl of KAPA SYBR FAST qPCR Master Mix (2X) ABI Prism (Sigma-Aldrich), which contains a Taq DNA polymerase that lacks proofreading activity ...
-
bioRxiv - Physiology 2023Quote: ... AAV genome copy numbers were quantified with qPCR using FastStart Probe master mix (Sigma, Germany) on a CFX96 thermal cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 25 µL of KOD polymerase (KOD Hot Start Master Mix, Sigma-Aldrich, Cat. No. 71842), and water for a final volume of 50 µL ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR mix was prepared using gene-specific primers (0.6 μM, Sigma, primer sequences in the Appendix Table S1 and S2 ...
-
bioRxiv - Neuroscience 2021Quote: ... using the SYBR™ Green master mix (life technologies) and predesigned primers (KiCqStart® Primers, Sigma). Relative gene expression levels were normalized to β-actin in each sample with the ΔΔCT method.
-
bioRxiv - Microbiology 2020Quote: ... A region of pol (44, 45) was amplified using KOD Hot Start Master Mix (Millipore, 71842) in a first round of PCR with forward primer ...
-
bioRxiv - Systems Biology 2020Quote: ... 4μl of a master mix containing 2.5μl of 1M triethylammonium bicarbonate (TEAB, Millipore Sigma T7408-100ML), 1.3μl of 200ng/μl trypsin (Promega Trypsin Gold ...
-
bioRxiv - Cancer Biology 2021Quote: ... The antibody master-mix was then filtered through a pre-wetted 0.1-μm spin-column (Millipore) to remove antibody aggregates ...
-
bioRxiv - Microbiology 2022Quote: ... Eighty µl of a master reagent mix (20 µl bicine buffer (1M, pH 8, Sigma-Aldrich), 10 µl H2O ...
-
bioRxiv - Plant Biology 2023Quote: ... The total of 10 mL master mix solution was made of 10 µL of Luminol (Sigma) from 100 mM stock solution in DMSO ...
-
bioRxiv - Synthetic Biology 2023Quote: ... KAPA SYBR FAST polymerase master mix was purchased from Sigma-Aldrich (St. Louis, MI, United States).
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (2X) Universal (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... DNA fragments were directly purified from the PCR mix using the GenElute PCR Clean-Up Kit (Sigma-Aldrich). Gibson assemblies were performed with the NEBuilder HiFI DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 10 μl of RedExtract-N-ampl PCR reaction mix (Sigma-Aldrich), 0.8 μl of each primer (10 M) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed using JumpStart REDTaq Ready Mix (Sigma, Cat#P0982-800RXN) and the primers listed below ...
-
bioRxiv - Bioengineering 2021Quote: ... and the cell pellets were lysed in 200 µL of Bugbuster Master Mix (Merk Millipore, Damstadt, Germany). After centrifugation ...
-
bioRxiv - Biochemistry 2022Quote: ... after which inclusion bodies were isolated from the pellet according to manufacturer’s protocol (BugBuster Master Mix, Novagen). Purified IBs containing BbHtrA were resuspended in Denaturing/Binding buffer (20 mM phosphate buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were pelleted again before lysis with using 5 mL BugBuster® Master Mix (EMD Millipore, USA) for each gram of cells ...
-
bioRxiv - Physiology 2022Quote: ... Amplification of 300 ng of DNA was performed using KOD Hot Start Master Mix (Sigma-Aldrich 71842), forward and reverse primers of the mutations (USP8 Forward ...
-
bioRxiv - Developmental Biology 2023Quote: ... marinus genomic DNA (gDNA) or st18-st26 embryonic cDNA using KOD Hot Start Master Mix (Millipore Sigma) with primers listed above ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using FastStart Universal SYBR Green Master (Rox) (Sigma, 4913850001) on a Bio-Rad CFX Connect Real-Time PCR detection system ...
-
bioRxiv - Genetics 2022Quote: ... Real-time PCRs were done in a 10 μl volume using the Absolute quantitative PCR SYBR Green mix (Sigma) in a 96-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 µL of diluted cDNA was mixed with 12,5 µL ReqTaq® Ready Mix™ PCR reaction mix (Sigma Aldrich, #R2523), 0,5 µL forward primer (0,2 µM) ...
-
bioRxiv - Genomics 2019Quote: ... The libraries were PCR amplified with KAPA HiFi Hotstart Ready mix (Sigma-Aldrich) and barcoded Nextera custom primers 17 and finally size-selected (250–350 bp ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix was: 0.45 µL DMSO for PCR (Sigma; cat# D8418-50mL), 0.0045 µL SYBR Green I (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Cell-surface antibody master-mix in CSM was filtered through a pre-wetted 0.1 μm spin-column (Millipore) to remove antibody aggregates and added to the samples ...
-
bioRxiv - Genetics 2023Quote: ... Ligation master mix was set up at room temperature and 5.2 μL added per well (ligation master mix = 1.63 μL 50% PEG 8000, 0.97 μL 1,3 propanediol (Millipore 807481), 0.75 μL SCR Buffer ...
-
bioRxiv - Neuroscience 2022Quote: Genotyping for the R1.40 transgene locus was done with the recommended PCR primers using the PCR Ready Mix kit (E3004; Sigma-Aldrich). The sequences of the genotyping primers were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...
-
bioRxiv - Microbiology 2021Quote: ... which was combined with 10µL of KiCqStart SYBR Green PCR Ready Mix (Millipore Sigma), 1µL of forward primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR was performed with SYBR Green Jump-start Taq Ready-mix (Sigma, S4438) on the Mx3005P qPCR System (Agilent Technologies Genomics) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Q-PCR was performed with SYBR Green Jump-start Taq Ready-mix (Sigma, S4438) on the Mx3005P qPCR System (Agilent Technologies Genomics ...
-
bioRxiv - Developmental Biology 2019Quote: ... qRT-PCR was performed using the SYBR Green JumpStart Taq Ready Mix (Sigma Aldrich) on an ABI Prism 7900 system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... qRT-PCR was performed with the SYBR Green JumpStart Taq Ready Mix (Sigma – S4438) and custom-made primers (Table S6 ...
-
bioRxiv - Genetics 2023Quote: ... qRT-PCR was performed with the SYBR Green JumpStart Taq Ready Mix (Sigma – S4438) and custom-made primers (Table S4 ...
-
bioRxiv - Biophysics 2024Quote: ... 45 μL of proteinase K (PK) mix (20 μg PK (Sigma Aldrich, PCR grade), 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting supernatant was used for genotyping through REDTaq PCR Reaction Mix (Sigma Aldrich). Specific primer sets were applied to detect the CMV-Cre and IL-17A transgenes ...
-
bioRxiv - Genetics 2020Quote: ... and 1 μl of 1:10 diluted DNA was used as a template for PCR using the REDTaq ReadyMix PCR Reaction Mix (Sigma-Aldrich). The PCR conditions were as follows ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-CTGGGAGTATACTTGTAGTC-3) were run in multiplex with PCR reaction mixtures consisting of 10 μl redtaq (REDTaq ReadyMix PCR Reaction Mix, Sigma-Aldrich), 2 μl DNA ...
-
bioRxiv - Neuroscience 2019Quote: ... We added 3 μl instead of 4 μl of master mix containing only 1.7 μl instead of 2.7 μl of 1 M Trehalose (Sigma-Aldrich) directly to the 2 μl cell lysate without a SPRI bead cleanup step ...
-
bioRxiv - Microbiology 2021Quote: ... the cell suspensions were spun at 10,000 x g for 10 minutes and bacterial pellets were lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Microbiology 2021Quote: ... spun at 10,000 x g for 10 minutes and bacterial pellets lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PRC using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...
-
bioRxiv - Microbiology 2019Quote: ... a pellet corresponding to a 250 ml culture was resuspended in 1.5 ml of BugBuster Master Mix (MD Millipore) supplemented with 50 μl of DNAse I (5mg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... The cell suspensions were centrifuged at 10,000 x g for 10 minutes and bacterial pellets were lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA corresponding to the fxn gene was amplified using KOD hot start master mix (Cat. N° 71842 Millipore) and FwDdFXNOE and RevDdFXNOE as primers (Table 1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative (q)PCR was performed using SYBR Green Jump Start Taq Ready Mix (Sigma S4438) and Intron-spanning primer pairs (Supplementary Table 5 ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Immunology 2022Quote: ... Each panel was prepared as a single-test master mix in total 100µL with 100mM D-(+)-Trehalose dehydrate (Sigma-Aldrich) and 0.1X cell staining medium (CSM ...