Labshake search
Citations for Millipore Sigma :
1 - 50 of 1752 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... For genotyping PCR JumpStart RedTaq PCR master mix (Sigma-Aldrich) was used following the manufacturer’s protocol for cycling with an annealing temperature of 55°C and 35 cycles.
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared using 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, Gillingham, UK), 0.4 µL ROX High ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed with the KOD Hot-start 2× master mix (Novagen), and cloning was performed using Gibson Assembly 2× Master Mix (New England BioLabs ...
-
bioRxiv - Genetics 2021Quote: ... The PCR master-mix used was: Taq polymerase (Novagen NovaTaq 0.04U/μL), primers (0.5 μM each) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was performed using KOD Hot Start Master Mix (Millipore Sigma) with primers listed in Supplementary Table 6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Diluted cDNA was amplified by PCR using the Sybr Green Master Mix (Sigma), and raw threshold-cycle time (Ct ...
-
bioRxiv - Bioengineering 2019Quote: PCR master mix: 1x KOD Xtreme Hot Start DNA Polymerase buffer (EMD Millipore), 1.2 µM (each ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA fragments were PCR-amplified with KOD Hot Start Master Mix (Novagen®) from genomic DNA of M ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitate PCR was conducted using KAPA SYBR FAST Master Mix (Sigma-Aldrich, KK4611) on a Roche Lightcycler 96 (Roche Life Science) ...
-
bioRxiv - Genetics 2019Quote: ... PCR plates were filled with a master mix for KOD Hotstart (Novagen #71086) PCR reactions containing Lister427 gDNA according to manufacturer’s specifications and primer pairs specific to each ORF were transferred into the associated well number for each plate by TECAN Freedom EVO 150 pipetting instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using FastStart Universal SYBR Green Master Mix (Sigma, 4913850001). The aggregates of three housekeeping genes (B2m ...
-
bioRxiv - Genomics 2020Quote: ... we added 11 µl of KAPA2G Robust PCR master-mix (Sigma Catalogue No. KK5005), comprising 4 µl KAPA2G buffer ...
-
bioRxiv - Microbiology 2020Quote: ... A second round of PCR performed with KOD Hot Start Master Mix (Millipore, 71842) supplemented with 1mM MgCl2 under the following parameters ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: ... 2 μL of sample was added to 1x PCR Master Mix (Sigma-Aldrich, Basel, Switzerland) and the 4 degenerate primers at a final concentration of 1 μM each in a final volume of 25 μL ...
-
bioRxiv - Genomics 2019Quote: ... We performed qRT-PCR using FastStart Universal SYBR Green Master Mix with ROX (Sigma, 4913914001) on a ViiA 7 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Immunology 2022Quote: ... cDNAs were mixed with indicated gene-specific primers and SYBR green PCR Master Mix (Sigma), and qRT-PCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR system.
-
bioRxiv - Microbiology 2020Quote: ... Cyber Green master mix (Sigma Aldrich) was used for both qPCR and nl-qPCR however there was 1.8-fold more DNA in nl-qPCR reactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR reactions were run under standard conditions using KOD Hot Start Master Mix (Sigma-Aldrich: 71842). After subsequent ligation with T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR analysis was performed using the KAPA SYBR Fast PCR master mix (Sigma Aldrich, #KK4605) or SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Each 20 µl PCR reaction contained 10 µl of JumpStart RedTaq DNA Polymerase Master Mix (Sigma), 8 µl dH2O ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction mixture consisted of Kappa Probe Fast qPCR Master Mix (2X) Kit (Sigma-Aldrich), 0.75 μL of primers and 2.5 μL of RNA in a final volume of 10 μL reaction ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR mixtures (10 μL) contained 5 μL Kapa SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich), 300 nM of the primer pair ...
-
bioRxiv - Microbiology 2020Quote: ... Novagen Bugbuster Master Mix (Novagen, Merck, USA) and three additives (NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in BugBuster Master Mix (EMD Millipore) (volume ...
-
bioRxiv - Systems Biology 2023Quote: ... 70 µl BugBuster master mix (EMD Millipore) was added to each sample ...
-
bioRxiv - Cell Biology 2021Quote: ... and Sox2 cDNA were amplified by real-time qPCR using a SYBR PCR Master Mix Kit (Sigma-Aldrich) and a 7500 Real-Time PCR Detection System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2019Quote: The +2.0drl regulatory element was amplified from the zebrafish vector +2.0drl:EGFP by PCR using KOD Hot Start Master Mix (Novagen) (Table S1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and this sequence was amplified by PCR from 3’ RACE cDNA using KOD Hot Start Master Mix (Novagen) with the following primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... marinus genomic DNA or from stl8-26 embryonic cDNA by PCR using KOD Hot Start Master Mix (Novagen). 3’ rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed in triplicates with the KAPA SYBR® Fast qPCR Master mix (Sigma-Aldrich, KK4600) using a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: Viral barcodes were amplified in 50 µl PCR reactions using KOD Hot-Start Master Mix (Sigma-Aldrich, 71842). For the viral supernatant samples ...
-
bioRxiv - Microbiology 2021Quote: ... and LuminoCT Taqman Master Mix (#L6669; Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and KOD Hot Start Master Mix (Millipore Sigma). Amplicons from clone #8 were sent to Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core for Complete Amplicon Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... lysed in 300 µL Bugbuster Master Mix (Millipore), and clarified before analyzing supernatants by absorption and fluorescence spectroscopy in a Tecan 20M plate reader ...
-
bioRxiv - Microbiology 2019Quote: ... with the universal primers NL1 (GCATCAATAAGCGGGAGGAAAG) and NL4 (GGTCCGTGTTTCAAGGGG. A master mix solution was prepared containing 25 µl of KOD (Hot start Master Mix-Sigma Aldrich), 1.5 µl of each primer and 18.5 µl of NFW ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Biophysics 2020Quote: ... VDAC1 proteins were extracted with BugBuster Master Mix (Novagen) and purified with Ni-NTA His·Bind Resins (Novagen) ...
-
bioRxiv - Genetics 2023Quote: ... and SYBR green master mix kit (Sigma, Aldrich, Germany) respectively according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2019Quote: ... for synthesizing the probes was amplified using the primers described in Table S3 as following: the PCR reaction was set with KOD hot start master mix (#71842, Novagen), according to the manufacturer’s instructions and subsequently purified (#28706 ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Microbiology 2020Quote: ... Fragments were amplified using a high-fidelity polymerase mix (KOD Hot Start Master Mix, Millipore) and purified on a 1% agarose gel ...
-
bioRxiv - Physiology 2021Quote: ... FastStart Universal SYBR Green Master Mix (4913850001) was from Millipore-Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were extracted with the BugBuster ® Master Mix (Novagen), according to manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl KAPA SYBR FAST 2× Master Mix (Sigma-Aldrich) and 2 µl Milli-Q water ...
-
bioRxiv - Immunology 2022Quote: ... KAPA SYBR® Fast qPCR Master Mix (2x) Kit (Sigma), was used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Protein was extracted using BugBuster Master Mix (Sigma Aldrich, 71456), mixed 1:1 with 2x laemmli sample buffer (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... We used KOD Hot Start Master Mix (EMD Millipore, 71842) to perform all PCRs ...
-
bioRxiv - Immunology 2024Quote: ... KAPA SYBR FAST qPCR Master Mix (2X) (Millipore Sigma; KK4600) and a QuantStudio 7 Pro qPCR (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared by combining the following reagent volumes per sample: 15 µl of Platinum PCR Supermix UDG (Sigma Aldrich, USA), 0.25 µl each of Forward and Reverse Primers (10 µM ...