Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for Mouse DEFB15 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Induction of the shRNA was performed with doxycycline hyclate (Sigma Aldrich) at 2 µg/mL for 72 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (TRCN0000013109; TRCN0000013108) and HSPA5 (TRCN0000001024) shRNAs were purchased from Millipore-Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... shRNA expression was induced using 1 µg/mL doxycycline (Sigma, D9891) for 72 h before seeding ...
-
bioRxiv - Genomics 2022Quote: ... Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID: TRCN0000255746) and cloned into the pLKO.5-puro lentiviral construct (Sigma SHC201) ...
-
bioRxiv - Developmental Biology 2023Quote: ... non-targeting shRNA control (shCtrl: SHC016) were purchased from Sigma-Aldrich. Tetracyclin (Tet ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1-puro-shRNAs-Vectors for Control (Sigma-Aldrich, #TRCN0000382379), LSD2 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were transduced with lentivirus of MISSION TRC1-shRNA (Sigma) knocking down candidate substrates at DIV4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg of an shRNA vector (pLKO.1-puro vector-Sigma), 2 µg pMD2.g ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: HemEC (n=3) were transduced with SOX18 shRNA lentivirus (TRCN0000017450, Sigma) or an empty vector control virus (Sigma SHC001V ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... The SLC25A1-specific shRNA vectors were purchased from Sigma (TRCN0000232825; TRCN0000255350) and validated before (6,18,24) ...
-
bioRxiv - Cancer Biology 2021Quote: ... non-targeting scrambled shRNA served as control (shc002, named shCtrl, Sigma-Aldrich). SMO-inhibitor resistant Daoy cells with shRNA-mediated knockdown of SUFU had been generated in our lab using the TRCN0000019466 construct (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pLKO.1-puro Non-Mammalian shRNA Control (Sigma#SCH002), pLKO.1-puro.shSLX4IP.1 ...
-
bioRxiv - Molecular Biology 2020Quote: Five MISSION shRNAs specific for each splicing regulator were purchased from Sigma in pLKO lentiviral vectors and their effects were compared with those of SHC002 mammalian non-targeting MISSION shRNA (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: GOT2 shRNA vectors were purchased in bacterial glycerol stocks from Sigma-Aldrich Mission shRNA (mouse shRNA A ...
-
bioRxiv - Physiology 2022Quote: ... shRNA knockdown was achieved by transduction of Mission Lentiviral particles (Millipore, Sigma): Control shRNA-Cat#SHC002V ...
-
bioRxiv - Physiology 2022Quote: ... shRNA knockdown was achieved by transduction of Mission Lentiviral particles (Millipore, Sigma): Control shRNA-Cat#SHC002V ...
-
bioRxiv - Genomics 2022Quote: ... shRNAs in a pLKO.1-puro backbone were purchased from Sigma Aldrich Mission shRNA library (SHCLNG) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mission shRNA glycerol stock for CDH1 (NM004360, TRCN0000237841) was obtained from Sigma. Bacterial culture was started and incubated for 16 h (overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with pLKO.1 puro vectors (Sigma Mission shRNAs) or pLV-IRES Lenti Puro TRAF4 along with lentiviral packaging plasmids (pCMV-VSVG ...
-
bioRxiv - Neuroscience 2020Quote: Three different shRNA clones targeting Tril (Sigma-Aldrich, St Louis, MO, USA) and scramble lentiviral particles were used for the overall knockdown experiments (35) ...
-
bioRxiv - Molecular Biology 2020Quote: Bacterial glycerol stocks of MISSION® shRNAs were purchased from Sigma Aldrich for ...
-
bioRxiv - Microbiology 2021Quote: ... 5 validated LAMP1 shRNAs were ordered from human Mission lentiviral library (Sigma). HEK293T/17 and A549 cells grown to ∼70% confluency in 6-well plates were transduced with 0.5 ng p24/well of shRNA pseudoviruses ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNAs targeting Lamin-A/C and BRCA2 were purchased from Sigma Aldrich, lamin-A and progerin expressing plasmids were a gift from Brian Kennedy (Buck Institute ...
-
bioRxiv - Cancer Biology 2020Quote: ... All shRNAs for RBM10 were obtained from Sigma Aldrich (TRCN0000233276 and 0000233277). Sequences for individual shRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... MISSION shRNA constructs were obtained in pLKO.1-puro vectors from Sigma: SLK#1 (TRCN0000000895) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A scrambled non-targeting shRNA was used as control (Sigma-Aldrich #SHC016). Lentivirus was packaged as previously described (52 ...
-
bioRxiv - Microbiology 2022Quote: ... or MISSION pLKO.1-puro Non-Mammalian shRNA Control (Sigma-Aldrich, SHC002) were first transfected into HEK293T cells to produce lentiviral particles ...
-
bioRxiv - Cancer Biology 2023Quote: ... MISSION shRNA constructs were obtained in pLKO.1-puro vectors from Sigma: EZR (TRCN0000062459) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pLKO.005-puro with shRNA target sequence GTTGGCCTGAACCTGCTTTAT (TRCN0000382281, Millipore Sigma), as clones 1 and 2 ...
-
bioRxiv - Developmental Biology 2023Quote: The MAP3K1 shRNA lentiviral vectors were purchased from Sigma (Clone ID, TRCN000000616), and plasmids for CRISPR/Cas9 Synergistic Activation Mediator (SAM ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs depleting BLTP2 (TRCN0000128930, TRCN0000129099, TRCN0000130217, TRCN0000128410, TRCN0000129809) was purchased from Millipore-Sigma as bacterial glycerol stocks ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the shRNA vector for TGFBR1 was obtained from Sigma (SHCLNG-NM_004612, TRCN0000196326). These vectors were then transfected into HEK293T cells using the calcium carbonate method ...
-
bioRxiv - Microbiology 2020Quote: ... shRNA constructs were cloned into the Mission pLKO.1 lentivirus system from Sigma. The following antibodies were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... were used to generate lentivirus particles expressing PP4C-targeting shRNA obtained from Sigma: shRNA-1 (TRCN0000010737) ...
-
bioRxiv - Cell Biology 2020Quote: ... lentiviral vectors (pLKO.1) encoding either a non-targeting shRNA (SHC016, Sigma-Aldrich) or shRNA directed against human IP6K1 (TRC0000013508 ...
-
bioRxiv - Cancer Biology 2022Quote: ... from The RNAi Consortium (TRC) library collection: control shRNA (Sigma-Aldrich, cat. SHC002); RELA/p65 shRNA-1 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293 cells were transfected with lentiviruses particles containing Pin1 shRNA (Sigma-Aldrich, TRCN0000010577) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were transfected with Tln1 esiRNA (EMU083531, Sigma Aldrich) or ...
-
bioRxiv - Developmental Biology 2019Quote: Bacterial glycerol stocks for JAG1 and DLL4 MISSION shRNA were purchased from SIGMA. MISSION shRNAs ...
-
bioRxiv - Cell Biology 2019Quote: ... These sequences were selected from The RNAi Consortium (TRC) Mission shRNA library (Sigma) versions 1.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... Rictor-/- MEFs were infected with lentiviral particles encoding an shRNA targeting TBK1 (Sigma) (mouse TBK1 # TRCN0000323444 ...
-
bioRxiv - Cancer Biology 2019Quote: LRP5 & LRP6 shRNA constructs were obtained from the RNAi Consortium database (Sigma Aldrich). Lentivirus was packaged in HEK293T cells (ATCC ...
-
bioRxiv - Genetics 2021Quote: ... five independent DUSP16-targetting shRNA lentiviral vectors from the MISSION® library (Sigma) were transduced in HT-29 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Sfrp1 and Sfrp2 were designed using the MISSION shRNA library from Sigma-Aldrich and ligated using the Rapid DNA ligation kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by knockdown using stable short hairpin interfering RNA (MISSION shRNA, Sigma Aldrich) targeting the 3′UTR of human EZH2 (TRCN0000286227) ...
-
bioRxiv - Cancer Biology 2021Quote: The pLKO.1 shRNA construct targeting MYCN (TRCN0000020694) was purchased from Sigma-Aldrich and the pLKO.1 GFP shRNA was a gift from D ...
-
bioRxiv - Cell Biology 2020Quote: ... a specific short hairpin RNA (shRNA) construct set was obtained from Sigma-Aldrich, and lentivirus production plasmids psPAX2 and pMD2.G were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Individual shRNA and ORF vectors used were from the Mission TRC library (Sigma), and ORF collections were developed by members of the ORFeome Collaboration (Sigma/TransOMIC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... FBP1 (TRCN0000050034, TRCN0000050035) and PP2A-C (TRCN0000002483, TRCN0000002486) shRNAs were purchased from Sigma. SgALDOB was constructed by cloning the guide sequences into the BsmBI site of the lentiCRISPR v2-puro vector ...
-
bioRxiv - Genetics 2022Quote: Viral particles were made from shRNA lentiviral vector targeting human EGR1 (Sigma-Aldrich MISSION shRNA Target Clone ID TRCN000027385 ...