Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade E CM244 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... were as follows: Human pLKO.1-puro-shRNAMAPK14 (Sigma SHCLNG-NM_001315; TRCN0000000511), Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human epidermal growth factor (EGF, 20 ng ml−1; Sigma-Aldrich, E9644), human fibroblast growth factor (FGF ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 1µg 13C and 15N labelled human Apolipoprotein (Apo-1) (Sigma) as a known standard to 50µg total mycelial extract to assess the variance during sample preparation and measurements ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 g/L D-glucose with 1.25% human serum albumin (HSA) (Sigma) and either physiologic (0.1 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse antibody specific for human SOD1 (SD-G6 1:100, Millipore Sigma), Mouse anti-human HSP70 specific for stress-inducible HSPA1A (SMC-100B 1:100 ...
-
bioRxiv - Microbiology 2024Quote: ... were coated with 1/20,000 dilution of Goat anti-Human Fab (Sigma) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 penicillin/streptomycin and 10% male human AB serum (Sigma-Aldrich) (“T-cell medium”) ...
-
bioRxiv - Developmental Biology 2019Quote: ... adjusted to 340±5 mOsm with H20) then treated with 20 mg/ml Pronase E in L15/FBS buffer (10% FBS and 1% Penicillin-Streptomycin -Sigma P4458-in L-15 insect medium ...
-
bioRxiv - Immunology 2023Quote: ... were plated in P96 plates and infected overnight with BCG at an MOI of 10 or Mtb at an MOI of 1 or stimulated overnight with 100 ng LPS (from E. Coli 011: B4, Sigma) and 10 µM nigericin sodium salt (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: Cells were seeded onto glass coverslips coated with 5 µg/mL human plasma fibronectin purified protein (EMD Millipore Corporation) at a density of 80,000 cells and 40,000 cells for the PDGFRα homodimer cell line and PDGFRβ homodimer cell line ...
-
bioRxiv - Developmental Biology 2020Quote: Cells were seeded onto glass coverslips coated with 5 μg/mL human plasma fibronectin purified protein (Millipore Sigma #FC010). At ~90–100% confluency ...
-
bioRxiv - Cell Biology 2020Quote: ... The reaction was initiated by the addition of 6 μM vitamin D binding protein [DBP] (Human DBP, G8764, Sigma) directly in the fluorometric cuvettes ...
-
bioRxiv - Developmental Biology 2021Quote: ... plates were coated with fibronectin (Human Plasma Fibronectin Purified Protein, Sigma-Aldrich, 5µg/ml in PBS, 1h at RT).
-
bioRxiv - Neuroscience 2023Quote: Protein lysates were collected from primary human and murine spinal cord astrocytes in radioimmunoprecipitation assay (RIPA) buffer (Sigma-Aldrich) supplemented with a protease and phosphatase-3 inhibitor cocktail (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cytokine analysis was performed by Cincinnati Children’s Hospital Research Flow Cytometry Core per kit instructions (Milliplex MAP human protein panel, Millipore-Sigma).
-
bioRxiv - Cell Biology 2023Quote: Chromosomes were labeled by either injecting mRNA encoding human H2B-mCherry or H1 protein purified from calf thymus (Sigma) labeled with AlexaFluor 568 or 647 as described previously (Bun et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 0 n g/ml h uman E GF (Sigma), 0.5 mg/ml hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... Rotenone and Williams E Media from Sigma-Aldrich (Dorset, UK). Ammonium chloride ...
-
bioRxiv - Developmental Biology 2021Quote: ... Oocytes and embryos were incubated in 0.5% pronase E (Sigma) for 3-5 minutes to remove zona pellucida ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were stained with hematoxylin and eosin (H&E) (Sigma). Antigen retrieval was performed with citrate buffer pH6 ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on poly-D-lysine (PDL, A003-E, Millipore) coated 10 cm dishes ...
-
bioRxiv - Plant Biology 2021Quote: ... (1990) with 0.8% (w/v) agar (Type E, Sigma- Aldrich). When required ...
-
bioRxiv - Cell Biology 2022Quote: ... Isolated HFs were maintained in Williams E media (Sigma-Aldrich) supplemented with 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2020Quote: ... Parasites were sedimented on poly-lysine (A-003-E, SIGMA) coverslips (150µL/coverslip ...
-
bioRxiv - Cancer Biology 2022Quote: ... and stained with haematoxylin and eosin (H&E; Merck + Sigma) or IHC using antibodies of interest ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated with mouse anti-E-cadherin (Millipore, MAB1199) at 1:200 dilution in blocking solution at 37°C for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... 0.15 mM 2-Mercaptoethanol (Millipore, Cat. No. ES-007-E), 100 U/ml Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... transferred to the Immobilon-P/E PVDF membrane (Merck Millipore), and immunodetected using the SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... followed by additional infiltration with 20 μM E-64d (Sigma) for an 8 h period ...
-
bioRxiv - Neuroscience 2020Quote: ... Pronase E (Protease from Streptomyces griseus Type XIV, Sigma Aldrich) was diluted in water to a concentration of 2 mg/mL ...
-
bioRxiv - Neuroscience 2020Quote: E-4031 (Alomone-Labs, IL) and TEA (Sigma-Aldrich, USA) were dissolved in 0.9% saline ...
-
bioRxiv - Immunology 2020Quote: ... E-64 and 3-Methyladenine (3-MA) were from Sigma. Necrostatin-1 was from Abcam ...
-
bioRxiv - Genomics 2022Quote: ... 0.15 mM 2-Mercaptoethanol (Millipore, Cat. No. ES-007-E), 100 U/ml Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... 0.15 mM 2-Mercaptoethanol (Millipore, Cat. No. ES-007-E), 100 U/ml Penicillin- Streptomycin (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were stained with hematoxylin and eosin (H&E, Sigma) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to Immobilon-E PVDF Transfer membrane (Sigma, IEVH85R). Blocked the membrane with 5% skimmed milk and incubated with primary antibody i.e. ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 U Pyrophosphatase (E. coli, MFCD00131379 from Sigma-Aldrich®), 0.127 mg.ml−1 MtATPS ...
-
bioRxiv - Neuroscience 2022Quote: ... or lipopolysaccharide (LPS, Sigma-Aldrich, E. coli, O111:B4, L4391) dissolved in PBS at a dose of 5 mg/kg (cohort 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... sectioned (3 μm sections) and stained with H&E (Sigma). LLC tumor samples and dorsal skin were embedded in 3.5- 4 % agar ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal anti-α E-catenin (C2081) was from Sigma. Rabbit polyclonal anti-phospho-Myosin Light Chain 2 (Thr18/Ser19 ...
-
bioRxiv - Neuroscience 2023Quote: ... hNPCs were treated with 100 nM compound E (EMD Millipore) in Neural Medium for 48 hours and then maintained in Neural Medium supplemented with 20 ng/ml each of hBDNF and hGDNF for 3 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... Following resuspension in 50 ml/tube of E-MEM (Sigma), large cell aggregates were eliminated by filtering the cell suspension with a 60-μm stainless cell strainer (Ikemoto Scientific Technology) ...
-
bioRxiv - Biochemistry 2023Quote: ... William’s E Medium and hydrocortisone were purchased from Sigma Aldrich. Human insulin was purchased from pharmacy (Humulin N ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barium – gelatin mix (E-Z-EM Canada Inc; Sigma-Aldrich) was perfused until consistent pressure matching RVSP was obtained ...
-
bioRxiv - Bioengineering 2024Quote: Channel blockers E-4031 and nifedipine were purchased from Sigma, aliquoted in DMSO at a concentration of 10 mM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... D-Asp3-E-Dhb7-RR was purchased from Sigma Aldrich. Anabaenopeptin A and B ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5 x EmbryoMax 2-Mercaptoethanol (Merck Millipore #ES-007-E), 2.5 μg/ml Plasmocin (Invivogen) ...
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHH-Fcs or conventional human monoclonal antibodies was detected by HRP-conjugated rabbit anti-human IgG (Sigma, A8792, 1/2000). After washing 50 μL of TMB substrate (Tetramethylbenzidine ...
-
bioRxiv - Genomics 2023Quote: The lentiviral titer was determined by transducing 400,000 cells with increasing volumes (0, 1, 2, 5, 10, 20, and 40 μl) of concentrated virus and polybrene (6 μg/ml; Millipore, TR-1003-G). 48 hours after the transduction ...