Labshake search
Citations for Millipore Sigma :
651 - 700 of 2366 citations for Fish Sperm DNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: HPLC-grade DNA oligos (Sigma-Aldrich) were dissolved in sterile endotoxin-free water ...
-
bioRxiv - Systems Biology 2021Quote: ... DNA was labeled with Hoechst33342 (Sigma). Images were collected using a 63X ...
-
bioRxiv - Immunology 2020Quote: ... double stranded DNA (Sigma-Aldrich; D4522), insulin (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... ordered as complementary DNA oligonucleotides (Sigma) with overhangs for BbsI ...
-
bioRxiv - Immunology 2022Quote: ... HT-DNA (Sigma-Aldrich, Cat#D6898), Lipofectamine 2000 (Life Technologies ...
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... and Jumpstart Taq DNA polymerase (Sigma). The following PCR parameters were used ...
-
bioRxiv - Immunology 2022Quote: ... DNA using DAPI (Sigma-Aldrich, USA) and F-actin using Alexa Fluor 680 phalloidin (ThermoFisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and DNA with DAPI (D9542, Sigma). Appropriate secondary antibody was FITC-conjugated donkey-anti-rabbit immunoglobulins (Jackson Laboratories) ...
-
bioRxiv - Plant Biology 2023Quote: ... using KOD DNA polymerase (Merck Millipore). All plasmids were verified by sequencing.
-
bioRxiv - Immunology 2023Quote: ... double stranded DNA (dsDNA) (Sigma, D4522), single stranded DNA (ssDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-DNA (Sigma; 1:800) antibodies in 40 µL PBS for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10.7μg plasmid DNA (Sigma Aldrich; MX1 (#3 ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA (Millipore Sigma #CBL186, 1:200). Secondary antibodies conjugated to Alexa 405 ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA-RNA hybrid (Sigma-Aldrich, MABE1095), and anti-DNA PKcs (phospho S2056 ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA dye was Hoechst (Sigma-Aldrich B2261 used 1:5000 from a stock solution at 10 mg/ml) ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA primers were purchased from Sigma. Synthesis of N-acetyl-1-seleno-β-D-glucosamine (SeGlcNAc ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 100ml culture was harvested for DNA extraction using GeneElute –Mammalian Genomic DNA Miniprep Kit (Sigma- Aldrich). PCRs were done on different genomic regions flanking an IES.
-
bioRxiv - Microbiology 2022Quote: ... genomic DNA was prepared using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich, St. Louis, Missouri, USA) according to the manufacturer’s guidelines and sequenced at the Microbial Genome Sequencing Center (MiGS ...
-
bioRxiv - Biochemistry 2019Quote: TtClpP DNA was directly amplified from Thermus thermophilus HB8 DNA and cloned in to a pet41c (Novagen) expression vector with NedI and XhoI restriction enzymes ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was extracted from clonal cell lines using the GenElute Mammalian Genomic DNA kit (Sigma-Aldrich) and the K6a and K6b gene fractions where the indel mutations were expected were amplified by PCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... genomic DNA from EpiLC at D3 was isolated using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma) with RNase treatment ...
-
bioRxiv - Physiology 2022Quote: ... 2.5 μl of DNA template and 0.625 units JumpStart Taq DNA polymerase (Sigma-Aldrich, St. Louis, MO). PCR primers targeted a portion of the small-subunit (ITS-1507F,GGTGAAGTCGTAACAAGGTA ...
-
bioRxiv - Microbiology 2023Quote: The extraction of bacterial genomic DNA was performed using the GenElute Bacterial Genomic DNA kit (Sigma Aldrich), according to the instructions of the manufacturer.
-
bioRxiv - Developmental Biology 2023Quote: ... Add 0.5μL of live cell DNA stain (Vybrant DyeCycle Violet DNA Stain, Invitrogen or Hoechst 33342, Sigma) and 1.2 μL of 10mg/mL Propidium Iodide (PI ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNA was complemented to a total amount of 2 µg DNA per dish with ssDNA (Sigma Aldrich). After 24 h cells were transferred in 96 well plates (Greiner ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed as described by the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich, Darmstadt, Germany) using the kit’s columns and reagents following the protocol for Gram-positive bacteria for all samples ...
-
bioRxiv - Biophysics 2021Quote: ... The DNA-echinomycin complexes were prepared by mixing DNA duplexes in NMR buffer with 3x echinomycin (Sigma-Aldrich) dissolved in methanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... genomic DNAs were isolated from clonal populations using GenElute(tm) Mammalian Genomic DNA Miniprep Kit Protocol (Sigma-Aldrich). A genomic region of RIOK2 gene encompassing Ser483 was PCR-amplified from the genomic DNAs ...
-
bioRxiv - Immunology 2021Quote: ... calcium-phosphate-DNA-particle were generated by mixing the plasmid DNA’s with a 250 mM CaCl (Sigma-Aldrich) solution which was then added dropwise to an equal volume of 2 x hepes buffered saline and subsequently incubated for 20 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total genomic DNA was isolated using the GenElute Plant Genomic DNA Miniprep kit (Sigma-Aldrich, St. Louis, MO) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was isolated from CRISPR-edited and control cells using a GenElute Mammalian DNA Miniprep Kit (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We used a high fidelity Taq DNA polymerase for DNA amplification (Expand High Fidelity PCR system from Sigma). After that ...
-
bioRxiv - Genomics 2022Quote: DNA (0.5-1µg) was bisulfite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN) ...
-
bioRxiv - Bioengineering 2023Quote: ... Genomic DNA was extracted from ear slices with the GenElute Mammalian Genomic DNA Mini-prep Kit (Sigma-Aldrich). PCR was performed with PrimeSTAR® DNA Polymerase (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from cryopreserved patient tissue samples using GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA loading was assessed by re-probing the membrane with radiolabeled mouse genomic DNA with ethidium bromide (Sigma). Quantification of the spots was performed using ImageJ 1.53a.
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments were amplified with Phusion High-Fidelity DNA Polymerase andorigo primers (Sigma–Aldrich, St. Louis, MO, USA). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... and DNA counterstained with DAPI (Sigma Aldrich). Images were acquired on a Zeiss structured light ApoTome microscope equipped with a 63x/1.4 plan Apochromat objective and an Axiocam MRc5 camera using AxioVision software or a Zeiss LSM880 META confocal microscope equipped with a 63x/1.46 plan Apochromat objective and a GaAsP detector using Zen software.
-
bioRxiv - Cell Biology 2020Quote: ... DNA oligonucleotides were purchased from Sigma-Aldrich, from Integrated DNA Technologies (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... using JumpStart Taq DNA Polymerase (Sigma-Aldrich). A549 cells used in all sequencing experiments had their identity confirmed via STR profiling by ATCC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Taq DNA polymerase was from Sigma Aldrich. Amersham hybond-N+ nylon membrane was obtained from GE Healthcare Life Sciences ...
-
bioRxiv - Immunology 2022Quote: ... Herring-testis DNA was obtained from Sigma. For stimulation of cells by transfection ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1 mg/mL herring testes DNA (Sigma), and 2 μM sscGAS in 100 mM Tris ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA from Sterivex filters (Millipore Corporation) was extracted using a CTAB-phenol-chloroform-isoamylalcohol/bead beating protocol (modified after Nercessian et al. ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was stained using DAPI (Sigma-Aldrich). Images were taken as described before28,59.
-
bioRxiv - Genetics 2020Quote: ... DNA (1:1500) was from Millipore (CBL186), Goat Anti-rabbit Alexa Fluor 594 (1:1000 ...
-
bioRxiv - Biophysics 2021Quote: ... and the DNA with DAPI (Sigma-Aldrich).
-
bioRxiv - Microbiology 2021Quote: ... Hoechst DNA dye (cat. H6021, Sigma-Aldrich), and Alexa 647 fluorescently labelled goat anti-rabbit antibody (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL calf thymus DNA (Sigma D8661), 700 μL 0.1 M LiAc/TE ...