Labshake search
Citations for Millipore Sigma :
501 - 550 of 5985 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and plasmid DNA was purified from the resulting cell pellet using a GenElute HP Plasmid Maxiprep Kit (Sigma-Aldrich #NA0310) following the manufacturer’s recommended protocol with elution in 3 mL H2O ...
-
bioRxiv - Genetics 2019Quote: ... Minigenes were constructed by DNA assembly of PCR fragments that were amplified from HEK293T genomic DNA using KOD Hot Start DNA polymerase (Novagen). For the wild-type minigene ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments were amplified with either KOD Hot Start DNA Polymerase (Novagen) or standard Taq polymerase (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... on genomic DNA prepared with GenElute Mammalian Genomic DNA miniprep (Sigma-Aldrich). The sequences of oligonucleotides are given below.
-
bioRxiv - Cell Biology 2022Quote: ... DNA was complexed with X-tremeGENE 9 DNA Transfection Reagent (Sigma, 6365779001) in OptiMEM according to the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2024Quote: calf thymus DNA and supercoiled plasmid pUC19 DNA were obtained from Sigma Chemical Company ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant MejAgo protein expression and Ni-affinity chromatography purification procedures were performed according to user manual(Novagen). In perticular ...
-
bioRxiv - Bioengineering 2020Quote: ... Ultrapure water supplied by Milli-Q® Reference Water Purification System (Merck Millipore Corp., Billerica, MA, USA) was used for buffer preparation.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and ultrapure water was supplied by a Milli-Q water purification apparatus (Millipore Lda, Bedford, MA, USA). All solutions prepared for HPLC were filtered using a 0.45mm nylon filter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell pellets were used for purification of total RNA using 1 ml of TRI Reagent (Sigma-Aldrich) according to manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... no additional purification) in a concentration of 40 mg/ml was dissolved in distilled water (Millipore-Q) at 90 °C (temperature was controlled by the thermostat Qpod 2e ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were purified using the FLAG-affinity purification approach in the presence of benzonase (Sigma), and analyzed by SDS-PAGE and silver staining before subjected to Mass Spectrometry.
-
bioRxiv - Cell Biology 2020Quote: ... Purification of both protein constructs was similar: plasmid was transformed into the Rosetta2 strain of E.coli (Novagen). Two liters of culture were grown in terrific broth for 8-12h at 37°C (until the OD600 ~2) ...
-
bioRxiv - Microbiology 2021Quote: ... All work-up and purification procedures were carried out with reagent grade solvents (purchased from Sigma-Aldrich) in air ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunoblots from tandem affinity purifications were probed with antibodies against S-tag (mouse monoclonal MAC112; EMD Millipore) followed by visualization using IRDye-tagged secondary antibodies.
-
bioRxiv - Cell Biology 2023Quote: ... further processing was carried out using a standardized purification protocol employing homogenization in TRIzol (Sigma Aldrich, Merck) with an Ultra Turrax (IKA Labortechnik) ...
-
bioRxiv - Biochemistry 2023Quote: ... Ultra-pure water was obtained from a Milli-Q water purification system (Millipore, Bedford, MA, United States). Optimum cutting temperature compound (OCT ...
-
bioRxiv - Biochemistry 2023Quote: ... The protease inhibitor cocktail (PIC) used in our protein purifications was purchased from Millipore Sigma (catalog #P2714) and prepared as per the manufacturer’s instructions to generate a 1000X stock.
-
bioRxiv - Immunology 2024Quote: ... The supernatant collected for protein purification was purified with Centricon® centrifugal filter (10 K NMWL, Millipore). Concentrated IFN proteins were verified by western blot.
-
bioRxiv - Immunology 2019Quote: ... Sheared CT DNA (Sigma) and 2’3’ cGAMP (Invivogen ...
-
bioRxiv - Biochemistry 2019Quote: ... herring testes DNA (Sigma) was also run on each plate to ensure consistency of data.
-
bioRxiv - Immunology 2023Quote: ... purified DNA (Sigma-Aldrich), actin (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid DNA was recovered from 150 ml of this overnight culture using the GenElute™ HP Plasmid Midiprep Kit (Sigma-Aldrich) as per the manufacturer’s instructions except for a modified elution step ...
-
bioRxiv - Neuroscience 2021Quote: Eighteen-µm cryostat sections from the cerebrum were fixed in 4% PFA directly on slides and stained using the FragEL DNA Fragmentation Kit (QIA33; Millipore Sigma) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... ear notches were collected from mouse pups to extract genomic DNA using the RED Extract-N-Amp Tissue PCR Kit (Sigma-Aldrich). Ear notches were incubated in the tissue preparation (25 μl/sample ...
-
bioRxiv - Microbiology 2021Quote: ... We then used these primers (TTCGTCGTGAGACAGAGCGG, AGGCCATTGACGGATGGTTTGTAC) to amplify DNA from the two positive mosquitoes using the Expand™ Long Range dNTPack kit (Sigma) using the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... was prepared from an overnight culture in THB-Y broth and high-molecular-weight genomic DNA was isolated using the Sigma Genelute kit (Sigma Aldrich) according to the manufacturer′s instructions ...
-
bioRxiv - Immunology 2021Quote: ... we extracted genomic DNA from mouse tails and performed PCR with REDExtract-N-Amp™ Tissue PCR Kit following the manufacturer’s instructions (Sigma-Aldrich) and analyzed samples on agarose gel ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Yolk sacs from each of the dissected embryos were collected and genomic DNA preparation was done using Extract-N-Amp tissue PCR kit (Sigma-XNAT2). Placenta tissues were collected in RLT buffer and RNA was extracted using RNAeasy Mini Kit (Qiagen – 74104) ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic DNA was isolated from expanded clones after the second FACS sorting step using the GenElute mammalian genomic DNA miniprep kit (Sigma-Aldrich) and amplified in a PCR reaction using primers P1/P5 (Table 1 ...
-
bioRxiv - Genomics 2019Quote: ... Individual colonies were cultured overnight before isolation of plasmid DNA using the GenElute™ miniprep kit (Sigma-Aldrich, Catalogue No. PLN350). Purified plasmids were Sanger sequenced to confirm successful cloning ...
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from the si-NC and si-Dnmt3aos-transfected M(IL-4) macrophage cells and was then treated with bisulfite using the Imprint DNA Modification Kit (Sigma-Aldrich). Bisulfite sequencing and pyrosequencing were conducted by Shanghai Sangon Biotech Corporation ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA was extracted from wild type Ps LMG5084 and its PL1-insensitive mutants using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). Libraries were prepared with the NEBNext Ultra II library kit according to the manufacturer’s instructions and sequenced on the Illumina HiSeq X platform to obtain 150 bp paired end reads with an average depth of 40-fold ...
-
bioRxiv - Biochemistry 2019Quote: ... The DNA substrate was generated by PCR and the products were purified using a GenElute PCR Clean-up kit (Sigma-Aldrich). If required ...
-
bioRxiv - Biochemistry 2021Quote: ... The DNA substrate was generated by PCR and the products were purified using a GenElute PCR Clean-up kit (Sigma-Aldrich). If required ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Sigma-Aldrich) as previously described (41,44) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Sigma-Aldrich) as described previously (Rumi et al. ...
-
Treatment history shapes the evolution of complex carbapenem-resistant phenotypes in Klebsiella spp.bioRxiv - Microbiology 2022Quote: Genomic DNA of the Klebsiella isolates was prepared from solid media scrapings of pure culture using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) and the Gram-negative bacteria protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotypes were verified by PCR of tail DNA using the RedExtract-N-Amp Tissue PCR Kit (Sigma Aldrich 254-457-8).
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 or TFCP2L1 in the case of those imaged for confocal analysis ...
-
bioRxiv - Microbiology 2022Quote: DNA extraction was performed for each of the above isolated samples by following manufacturer’s instructions using the GenElute™ Bacterial Genomic DNA kit (Sigma-Aldrich). After gDNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted from mice ear tissues (or tail for embryos) using Extraction « Extract-N-Amp PCR » kit (Sigma #XNAT2-1KT) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation was then performed using 200 ng of 4C-template DNA with the Expand Long Range PCR kit (Millipore, 4829042001) under specific PCR conditions (94 °C for 2 min ...
-
bioRxiv - Genetics 2024Quote: ... digestion at 37 ᵒC for 20 minutes and used directly for bisulfite treatment using the Imprint DNA Modification Kit (Sigma MOD50) according to the manufacturer’s 2-step modification procedure ...
-
bioRxiv - Cancer Biology 2023Quote: ... Routine genotype analysis of mice was performed by PCR assay on DNA purified from tail biopsies (Extract N-Amp Tissue PCR kit, Sigma Aldrich). Wild-type and KO mutant alleles were distinguished using primers available on request ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans genomic DNA extracted from 8-10 adult worms using the Extract-N-Amp™ Tissue PCR Kit (Millipore Sigma, MA) as previously described38 then sequenced ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR sex genotyping reactions were performed in a final volume of 25 μl with the following reagents and volumes per sample: 12.5 μl KAPA2G Fast HotStart DNA Polymerase (5 U/μL) from the KAPA2G Fast HotStart PCR Kit (Sigma-Aldrich, KK5601), 1 μl of 12.5 μM Ube forward primer and 1 μl of 12.5 μM Ube reserve primer ...
-
bioRxiv - Biochemistry 2024Quote: ... Genomic DNA was extracted from 2 ml of overnight culture from each time point using the GenElute™ Bacterial Genomic DNA kit (Sigma) and 10 ng analysed by qPCR using a Light Cycler 480 real-time PCR system (Roche ...