Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 7H 1 3 Thiazino 2 3 i purin 5 1H one 2 3 8 9 tetrahydro 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Genetics 2020Quote: ... 137.14 mg of 2-methylpyridine-3-carboxylic acid (Sigma Aldrich, cat. 325228) were resuspended in 500 μl DMSO anhydrous (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2 mg/ml N-(3-dimethylaminopropyl)-N′- ethylcarbodiimide hydrochloride (Sigma, 03450) in 50 mM HEPES] for 30 min on slow agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitors (cocktail 2; P5726; and cocktail 3; P0044; Sigma-Aldrich). Lysates were incubated for 5 min at 100 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, P5726 and P0044). Homogenized sample was left incubating for disulfide bond reduction for 60 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: Spheroids were treated every 2-3 days with either GSK343 (Sigma-Aldrich), GSK126 (Selleckchem) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.05 mM (1,4-di [3’-(2’-pyridyldithio)propionamido] butane) (DPDPB, Sigma 16646) in PBS for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 and 3 inhibitor (Glutor, 0.05, 0.1, and 0.25 µM, Sigma, SML2765) for 6 to 72 hours ...
-
bioRxiv - Neuroscience 2023Quote: 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium (MTT) (Millipore Sigma) is converted to water-insoluble product formazan by reduction at mitochondrial complex II of the electron transport chain ...
-
bioRxiv - Biochemistry 2024Quote: ... exponentially growing TriEx cells (3 mL suspension, 2×106 cells/mL, Novagen) in serum-free Insect-XPRESS medium (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... Mice were anesthetized by exposure to 2% to 3% isoflurane (Sigma-Aldrich) for 5 to 10 minutes and intranasally infected with 40 μL of a suspension containing 105 spores for the leukopenic model and 106 spores for the corticosteroid model ...
-
bioRxiv - Microbiology 2024Quote: ... and media was replaced every 2-3 days with MEME medium (Sigma), supplemented with 2 mM L-Glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2021Quote: ... [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Neuroscience 2021Quote: ... [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore Sigma #P5726 and #P0044). Cells were scraped ...
-
bioRxiv - Cell Biology 2023Quote: ... was used at 1 µM and ARP 2/3 complex inhibitor - CK666 (182515; Sigma-Aldrich) was used at 100 µM concentration ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) for 3 min (1:5000, Sigma Aldrich), and mounted in prolong gold (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma, Saint Louis, MO, USA). Particulate was removed by centrifugation of lysates at 13,000 rpm for 10 minutes at 4°C and filtration through 0.45 µm syringe filters and lysates were stored at -80°C until preparation for MIB-MS ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Biochemistry 2022Quote: ... were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt, Aldrich) or negatively charged 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS, Sigma-Aldrich, Inc) containing N,N’-methylenebisacrylamide (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... (TDP43: 5’-gcaaagccaagaugagccu-3’ and EGFP control: 5’-gcaccaucuucuucaagga-3’; Sigma). Silenced cells were collected by trypsinization ...
-
Systemic administration of Ivabradine, an HCN channel inhibitor, blocks spontaneous absence seizuresbioRxiv - Neuroscience 2021Quote: ... and ELA (N-[4-[2-(3,4-Dihydro-6,7-dimethoxy-2(1H)-isoquinolinyl)ethyl]phenyl]-9,10-dihydro-5-methoxy-9-oxo-4-acridinecarboxamide) were purchased from Sigma-Aldrich. For systemic injections ...
-
bioRxiv - Immunology 2019Quote: Cell viability was monitored by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT; Sigma, USA) assay as previously described [52] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated with 50 µL of a 2 mg/mL solution of (3-(4,5-dimethyl-thiazole-2-yl)-2,5-biphenyl tetrazolium (MTT, Sigma-Aldrich) in PBS for 4 h and then exposed to 100 µL dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were washed with PBS and 3-(4,5-dimethyl-2-thiazolyl)2,5-diphenyl-2-H-tetrazolium bromide (MTT, Sigma-Aldrich) solution (final concentration ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were blocked for 1h in 3% BSA (Sigma), 0.3% Triton-X-100 (VWR ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were seeded into 6-well plates to reach 50-60% confluency on the day of infection and were transduced 2-3 consecutive days with the viral supernatant in the presence of 8 μg/mL polybrene (Sigma). The viral supernatant was replaced with fresh culture medium ...
-
bioRxiv - Immunology 2020Quote: ... 8-20 weeks after reconstitution chimeric mice were injected intraperitoneally for 3 d with 2 mg/day of tamoxifen (Sigma) re-suspended at 20 mg/ml in corn oil (Sigma ...
-
bioRxiv - Systems Biology 2024Quote: ... 2M thiourea, 100mM Tris-HCl, pH 8, 150mM NaCl, 1mM EDTA, phosphatase inhibitor cocktail 2 and 3, 10mM NaF; Sigma), reduced with 10mM DTT (dithiothreitol ...
-
bioRxiv - Cell Biology 2022Quote: ... one coated with 3-APTMS (Sigma) and other with hydrophobic coating ...
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After 24 hrs media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37 °C in 5% CO2 for 3 hrs ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Valine only labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887) and 150 mg/L sodium 4-methyl-2-oxovalerate (Sigma K0629) ...
-
bioRxiv - Biochemistry 2022Quote: ... Dimethyl LV labeling for geminal pair determination used 150 mg/L 2-Keto-(3-methyl-13C)-butyric-4-13C,3-d acid sodium salt (Sigma 589063). Valine only labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887 ...
-
bioRxiv - Biochemistry 2022Quote: ... 13C-ILV labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887) and 70 mg/L 2-Ketobutryic acid-4-13C,3,3,d2 sodium salt hydrate (Sigma 589276 ...
-
bioRxiv - Biochemistry 2021Quote: The competitive inhibition of human fumarase activity in the presence of 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910) was fluorometrically assessed using a coupled enzyme assay ...
-
bioRxiv - Physiology 2023Quote: ... In order to substitute cholesterol in the patch with cholest-4-en-3-one (cholestenone) the bath solution was replaced with 2 mM MBCD solution saturated with cholest-4-en-3-one (Millipore-Sigma, St. Louis, MO).
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Plant Biology 2020Quote: ... 2-3-week-old plants were treated with 150µM DCMU (D2425-100G, Sigma), kept for 1 hour in the dark and then exposed to high light (HL ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000037282 (shRNA Trim39#2) and TRCN0000438509 (shRNA Trim39#3) were from Sigma-Aldrich. Lentiviral particles were produced as previously described (Iréna Lassot et al. ...