Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 7H 1 3 Thiazino 2 3 i purin 5 1H one 2 3 8 9 tetrahydro 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and adenosine 5’-diphosphate sodium salt (ADP) (3 μM) (20398-34-9, Sigma Aldrich) were dissolved in phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Bioengineering 2019Quote: ... and 0.5 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate (8-Br-cAMP; Sigma-Aldrich B5386) in EGM for 6 days [30–34] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... BSA was coupled to the PEG (3000) for 1h at RT with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 100 mM, Sigma Aldrich, 39391) and N-hydroxy-succinimide (NHS ...
-
bioRxiv - Immunology 2022Quote: ... 3-isobutyl-1-methylxanine (IBMX, Sigma, #I-5879, 0.5 mM), insulin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... 3-isobutyl-1-methylxanine (IBMX, Sigma, #I-5879, 0.5 mM), insulin (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
bioRxiv - Immunology 2019Quote: ... and 3.3 mg 3-amino-9-ethylcarbazole (Sigma Aldrich) dissolved in dimethyl formamide/0.015% hydrogen perioxide/0.1M sodium acetate ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3-aminoethyl-9-ethylcarbazole as substrate (AEC, Sigma). Sections were counterstained with hematoxylin and cover-slipped with Aquatex ...
-
bioRxiv - Neuroscience 2022Quote: ... On selected sections, immunoreactivities were tested: SATB1 (mouse, 1:500, SantaCruz) and GluR 2/3 (rabbit, 1:500, Millipore) were diluted in 0.1 M PB and incubated overnight at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... Concentrated Cav1.2(ΔC)/Cavβ3/Cavα2δ-1 sample was immediately incubated with gabapentin (final concentration 2 mg ml-1, 11.7 mM) (Sigma-Aldrich) on ice for four hours prior to cryo-EM sample preparation ...
-
bioRxiv - Bioengineering 2019Quote: ... 8 mM MgCl2 (7786-30-3, Sigma), and 10 mM dithiothreitol (20-265 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Bradykinin 2-9 (PPGFSPFR, Sigma Aldrich), was spiked in as an HDX timepoint control peptide ...
-
bioRxiv - Immunology 2023Quote: ... 3 mg/mL collagenase I (Sigma, C0130) and 0.5 mg/mL DNase I (Sigma ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then stained for 2 minutes at room temperature using filtered 0.5% Solvent Black 3 (CAS Number 4197-25-5; Sigma 199664) dissolved in 75% ethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 µl of a solution of 5 mg/mL MTT [3-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma Chemical Co.) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were exposed to 5 μM CHIR99021 (Axon) between days 2 and 3 and then supplemented with 100 nM RA (Sigma) until day 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... after 72 hours of drug treatment, 20μl of a 5mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M2128-MTT; Sigma-Aldrich, USA) solution was added to each of the wells ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-GGTCAGCCAACTCGTCACAGTC-3’) and by alizarin red S staining with a 2% (w/v) alizarin red S solution (Sigma-Aldrich). Slides were imaged in an Olympus BX61 microscope ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Molecular Biology 2023Quote: Cytotoxicity of Quercetin and other natural compounds was evaluated using MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). Following the drug treatment in triplicate at indicated concentrations ...
-
bioRxiv - Bioengineering 2023Quote: ... 3 µL of 2 M CaCl2 and 5 µL of 10 mg/mL ε-aminocaproic acid (ε-ACA) (Sigma-Aldrich), and 1 µL of 1U/µL Thrombin (MP Biomedicals ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the brains were dissected to 2 mm slices and incubated for 10 minutes in freshly prepared 0.5% TTC solution (2, 3, 5-Triphenyltetrazolium chloride, Sigma-Aldrich). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... two to four-month-old mice were gavaged 3 times over 5 days with 2 mg tamoxifen (TX; Sigma #T5648) in corn oil (Sigma #C8267) ...
-
bioRxiv - Genetics 2024Quote: ... differentiation of iPSCs was induced through the Wnt modulation method with 7 μM glycogen synthase kinase 3 b (GSK3b) inhibitor CHIR99021 (Selleckchem) and 5 μM inhibitor of WNT production 2 (IWP2) (Sigma). Basal Media was composed of RPMI media supplemented with B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Three subsamples (∼2 ml) were taken from each section with a 3 ml syringe and immediately fixed in 2 ml RNAlater (Sigma Life Science) in a 5 ml tube (Qiagen ...
-
bioRxiv - Immunology 2022Quote: Fabs (2-4 mg/ml) were mixed with a 2 to 3-fold molar excess of fen-G4 or fentanyl (Sigma F-013) in Dulbecco’s PBS and incubated for 1-2 hours at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 the cell culture media was replaced 1-2 hours before imaging with RPMI media (Sigma-Aldric R8755) supplemented with B27 ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately1-2 μL of endotoxin-free DNA (1-3 mg/ml) diluted in PBS/0.025% Fast Green (SIGMA) was injected into the lateral ventricles of the forebrain using heat-pulled glass micropipettes (Drummond) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pellet was resuspended and incubated for 30 min at 4 °C in buffer B (10 mM Tris pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% Glycerol, 1 mM DTT, Sigma cOmplete EDTA-free Protease Inhibitor Cocktail) ...
-
bioRxiv - Biochemistry 2023Quote: ... and phosphatase inhibitors (prepared in-house according to Phosphatase inhibitor cocktail 1, 2 and 3 from Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μl of 5mg/ml MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma) was added to each well ...
-
bioRxiv - Cell Biology 2020Quote: Spheroids were cultured on dishes coated with 3% poly-2-hydroxyethyl methacrylate (polyHEMA) (Sigma, P3932), which was dissolved in 95% absolute ethanol overnight in magnetic stirrer at room temperature (RT) ...
-
bioRxiv - Cell Biology 2020Quote: ... RPE1 cells and LCLs were treated with 3 mM or 2 mM thymidine (Sigma, T9250) for 22 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Media was changed every 2-3 days for new media: DMEM/F-12 (Sigma-Aldrich) + 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2019Quote: The mitochondria-dependent reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) to formazan was used to assess cell viability ...
-
bioRxiv - Cancer Biology 2019Quote: Cell viability was accessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) assay ...
-
bioRxiv - Cancer Biology 2019Quote: Cell viability was accessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) assay ...
-
bioRxiv - Genomics 2020Quote: ... 3·106 cells were fixed in 400 μl of DPBS/2% Paraformaldehyde (Sigma P-6148) for 10 minutes at room temperature shaking ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4) containing protease inhibitor cocktail and phosphatase inhibitor cocktails 2 and 3 (Millipore-Sigma). 15 adult Drosophila males and females of different genotypes were harvested at 10 days post-enclosure ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4) containing protease inhibitor cocktail and phosphatase inhibitor cocktails 2 and 3 (Millipore-Sigma). 15 adult Drosophila males and females of different genotypes were harvested at 10 days post-enclosure ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich) at −80°C ...