Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 7 Oxabicyclo 4.1.0 hept 3 ene 2 5 dione 3 hydroxymethyl 4 1E 1 penten 1 yl 1S 6R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 500μM 3-isobutyl-1-methyxanthine (Sigma Aldrich), 1μM pioglitazone (provided by AZ) ...
-
bioRxiv - Physiology 2020Quote: ... 0.5mM 3-isobutyl-1-methylxantine (I5879, Sigma) and 0.1μM dexamethasone (D8893 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Par-3 (1:500, Millipore), mouse anti-aPKC (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-phospho histone 3 1:500 (Millipore)] were incubated with intact myofibers at room temperature for 1h followed by three washes in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Sigma), 0.2 mM indomethacin (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-isobutyl-1-methyl-xanthine (IBMX; Sigma) and 1 μM all-trans-retinoic acid (RA ...
-
bioRxiv - Cancer Biology 2021Quote: ... IBMX (3- Isobutyl-1-methylxanthine; Sigma, #I7018) was used at 50 or 500 μM ...
-
bioRxiv - Microbiology 2021Quote: ... 1% phosphatase inhibitor cocktail 3 (Millipore-Sigma). Zirconia beads were added ...
-
bioRxiv - Microbiology 2021Quote: ... 1% phosphatase inhibitor cocktail 3 (Millipore-Sigma). Zirconia beads were added ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-isobutyl-1-methyxanthine (Sigma Aldrich, I5879). Insulin (Actrapid Novonordisk ...
-
bioRxiv - Physiology 2020Quote: ... Cy-3 anti-rabbit 1:400 (Millipore), Alexa 488 donkey anti-mouse 1:400 ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μM 3-isobutyl-1-methylxanthine (Sigma), 100 μM 8-Bromoadenosine 3’,5’-cyclic monophosphate (Biolog) ...
-
bioRxiv - Cancer Biology 2022Quote: ... (3) Fibronectin (1:1000, F3648; Sigma-Aldrich)-Opal 570 ...
-
bioRxiv - Genomics 2022Quote: ... + 1-3% BSA (Sigma Aldrich, A7906-50G) + 50ul/ml propidium iodide ...
-
bioRxiv - Cell Biology 2023Quote: ... After 1-bromo-3-chloropropane (Sigma-Aldrich) addition and centrifugation (21000 g ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.5mM 3-isobutyl-1-methylxanthine (Sigma-Aldrich) and 1/1000 volume ABP (50 mg ml-1 L-ascorbate ...
-
bioRxiv - Neuroscience 2023Quote: ... Octenol (1-octen-3-ol, Sigma Aldrich, ≥ 98% purity ...
-
bioRxiv - Pathology 2024Quote: ... and 1-bromo-3-chloropropane (B9673, Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... 0.5 mM 3-Isobutyl-1-methylxanthine (Sigma), and 100 U/mL Penicillin-Streptomycin ...
-
bioRxiv - Molecular Biology 2023Quote: ... α14-3-3sigma (1:5000, Sigma, #PLA0201), α14-3-3pan (1:1000 ...
-
bioRxiv - Systems Biology 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (1:100, P5726 and P0044, Sigma-Aldrich). For immunoprecipitation (IP) ...
-
bioRxiv - Immunology 2020Quote: ... and cyclophosphamide (#C7397, 100 mg kg-1 from day −3 to −2; Sigma-Aldrich) intraperitoneally ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM Benzamidine) containing phosphatase inhibitor cocktail 2 and 3 (Sigma, P5726 and P0044). Supernatants containing proteins were collected after centrifugation at the highest speed for 15 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck ...
-
bioRxiv - Biochemistry 2022Quote: ... Valine only labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887) and 150 mg/L sodium 4-methyl-2-oxovalerate (Sigma K0629) ...
-
bioRxiv - Biochemistry 2022Quote: ... Dimethyl LV labeling for geminal pair determination used 150 mg/L 2-Keto-(3-methyl-13C)-butyric-4-13C,3-d acid sodium salt (Sigma 589063). Valine only labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887 ...
-
bioRxiv - Biochemistry 2022Quote: ... 13C-ILV labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887) and 70 mg/L 2-Ketobutryic acid-4-13C,3,3,d2 sodium salt hydrate (Sigma 589276 ...
-
bioRxiv - Biochemistry 2022Quote: ... and 3% hydrochloric acid followed by sample pooling via centrifugation at 1,500 rpm for 2 minutes to the proteoCHIP funnel part for direct injection or transferred to 0.2 mL PCR-tubes coated with 1e-3 % Poly(ethylene glycol) (95172-250G-F, Sigma-Aldrich, Germany).
-
bioRxiv - Microbiology 2022Quote: ... 150 μM (2-(2-nitro-1H-imidazol-1-yl)-N-(2,2,3,3,3-pentafluoropropyl) acetamide (EF5 compound; Sigma-Aldrich, EF5014), 0.5 μM MitoSOX™ fluorescent probe (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: Cytotoxicity of USP7 inhibitor P5091 and P22077 was determined by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay (Sigma-Aldrich, St. Louis, MO, USA). Cytotoxicity was assessed after 24 hrs and 48 hrs of inhibitor treatment in 96 well plates.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, purity > 98%) was purchased from Sigma-Aldrich (St. Louis, MO, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The following chemicals in high grade were obtained commercially or as a gift: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) (Sigma-Aldrich, St Louis, MO, USA); Raloxifene (Cipla Ltd. ...
-
bioRxiv - Neuroscience 2023Quote: The viability of SH-SY5Y cells after indicated treatments was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) assay ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were treated with 200μl media including 10 μL of MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyltetrazolium bromide, 5mg/mL) (Sigma-Aldrich, U.S., Cat. No. M2272) per well for 4h at 37°C (Ayazoglu Demir et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 4 mM 5-bromo-4-chloro-3-indolyl α-D-N-acetylneuraminic acid (Sigma) was added ...
-
bioRxiv - Immunology 2019Quote: ... MTT (1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan) and paraformaldehyde were obtained from Sigma Aldrich Co (St Louis ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EDTA) at 4 °C for 10 min before 3% of Ficoll-400 (Sigma) was added and assembled Nucleolin complexes were resolved on a 10% TBE PAGE gel at 4 °C.
-
bioRxiv - Neuroscience 2020Quote: ... SYSY), vesicular glutamate transporter 2 (VGLUT2; 1:1,000, SYSY) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, 1:50,000, Millipore) at 4 °C for 16 h ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...