Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 7 Oxabicyclo 4.1.0 hept 3 ene 2 5 dione 3 hydroxymethyl 4 1E 1 penten 1 yl 1S 6R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Sin1 (3-(4-5 Morpholinyl) sydnone imine hydrochloride (Sigma-Aldrich, Cat-M5793). Media products MEM and F12 (ratio 1:1) ...
-
bioRxiv - Plant Biology 2024Quote: ... The tissue was placed in 99.8% ethanol and LR White resin (at a ratio of 3:1, 1:1, 1:3; Sigma Aldrich, USA), and next in 100% resin LR White ...
-
bioRxiv - Cancer Biology 2021Quote: Cell viability was determined using a commercial 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) viability assay (Sigma Aldrich, Rehovot, Israel). That assay was used to determine how highly 4T1 proliferation was stimulated by Norepinephrine (NE ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Neuroscience 2020Quote: The viability of microglial cells was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Steinheim, Germany) assay as described previously [36] ...
-
bioRxiv - Cell Biology 2024Quote: We assessed mitochondrial activity using the 3-(4,5-dimethylthiazol-2-yl-)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (Sigma-Aldrich, Cat# M6494). As a tetrazolium dye ...
-
bioRxiv - Immunology 2024Quote: The viabilities of the PBMCs or U-937 macrophages were analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Cell Biology 2023Quote: ... (phenylmethylsulfonyl fluoride, PMSF 1mM; 1-chloro-3-tosylamido-4-phenyl-2-butanone, TPCK, 10 μg/ml; aprotinin, 10 μg/ml Sigma) incubated for 30min on ice ...
-
bioRxiv - Immunology 2022Quote: ... or Progesterone (Sigma, 4-Pregnene-3,20-dione; 1mg s.c) on day 9 of pregnancy ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... MTs were labeled with rat monoclonal antibody YL 1/2 directed against tyrosinated -tubulin (1:1000, Millipore), or rabbit polyclonal antibody against detyrosinated -tubulin (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM MgCl2 6 H2O and 5-Bromo-4-chloro-3-indolyl β-D-galactoside or X-gal (Sigma, B4252 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-bromo-3-chloropropane (Sigma), and 1 μg was reverse transcribed into cDNA using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ...
-
bioRxiv - Systems Biology 2022Quote: ... 1-3 grams of lysozyme (Sigma)
-
bioRxiv - Immunology 2022Quote: ... and 1-bromo-3-chloropropane (Sigma). cDNA was synthetized using SuperScript™ III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM 3-methyladenine (3MA) (Sigma), or 15 µM Ly294002 as pan-PI3K inhibitors ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1-octen-3-ol (Sigma O5284 ) acetophenone (Sigma 00790 ...
-
bioRxiv - Zoology 2019Quote: ... 3-methylthio-1-propanol (Sigma-Aldrich, Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-isobutyl-1-methylxanthine (IBMX; Sigma), human epidermal growth factor (hEGF ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 nM 3-MC (213942, Sigma) or DMSO (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1-bromo-3-chloropropane (Sigma) using phase separation method.
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit phosphohistone-3 (Millipore, 1:500), rabbit anti-active caspase (R&D ...
-
bioRxiv - Neuroscience 2023Quote: ... β3 tubulin (1:1000, Sigma #T8578), peripherin (1:1000 ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Systems Biology 2021Quote: ... at a 0.99:1 thiol-to-ene ratio in phosphate buffered saline (PBS, Sigma-Aldrich). Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Sigma-Aldrich and 50 µg mL−1 of 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal) (no. B4252; Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2021Quote: ... selected for 2-3 weeks with 1 µg/ml of puromycin (Sigma- Aldrich), and surviving cells were fixed with methanol and stained with Giemsa (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1% phosphatase inhibitor cocktails 2 and 3 (P5726 and P0044, Sigma-Aldrich) added fresh] or RIPA buffer [25 mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Microbiology 2019Quote: ... 1/200 (v/v) each phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), and 1/100 (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... 2.5mM Na3VO4 and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma) and set on ice for 10 minutes prior to sonication ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 3:2:1 in HEK 293T cells (Sigma Aldrich) using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 to 3 million cells were cross-linked using 1% formaldehyde (Sigma, F8775) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 from Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Bioengineering 2023Quote: ... The neuromodulators used are 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma-Aldrich) 50 µM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and active caspase-3 (1:1 000, Millipore, AB3623). Three fields of view for each slide were imaged using an Olympus BX43 Upright Microscope and cells were manually counted and scored using ImageJ Software.
-
bioRxiv - Biophysics 2022Quote: ... 250 μM 3-isobutyl-1-1-methylxantine IBMX (Sigma), 100 nM Cortisol (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 mM 3-Isobutyl-1-methylxanthine (IBMX, Sigma) in PBS for 15 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3-Hk (Sigma-Andrich; Catalogue number: 2147-61-7) was dissolved in distilled water using a vortex mixer for 10 minutes ...