Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamino-2-phenylindole (DAPI) (Sigma) in PBS for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) or fixable viability dye 405 (eBiosciences) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 mL of 300 kU/mL Deoxyribonuclease-I solution (DNase-I, Sigma-Aldrich, dissolved in 0.15 M NaCl supplemented with 5 mM CaCl2 and 1% pen/strep ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Sodium hydroxide (cat ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. 1× Phosphate Buffered Saline (PBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and incubated for 30 min with 10 µM 6-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate (DCFDA) and 1mg/L Hoechst 33342 dye (Sigma Aldrich, United States) diluted in media ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Neuroscience 2019Quote: ... the drug compounds (fluoxetine: Sigma-Aldrich, CAS No. 56296-78-7; ketamine: Sigma-Aldrich, CAS No. 1867-66-9; cycloserine: Sigma-Aldrich, CAS No. 68-41-7) were diluted in DMSO and applied in the setup to reach a final concentration of 20μM for each compound ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Neuroscience 2019Quote: ... after which 10 μM 6-TG (6-thioguanine or 2- amino-6-mercaptopurine, Sigma-Aldrich) with 200 μg/ml G418 selection was carried out for an additional 6-8 days ...
-
bioRxiv - Biochemistry 2020Quote: ... Acridine orange and FCCP (Carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone were purchased from Sigma and dissolved in DMSO.
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg/ml DNase I (Sigma-Aldrich) at 37°C for 20 min with occasional shaking ...
-
bioRxiv - Immunology 2022Quote: ... + 5 IU/mL Deoxyribonuclease I (#D4527, Sigma-Aldrich) + 0.1% RNasin Plus RNase Inhibitor (#N2618 ...
-
bioRxiv - Immunology 2023Quote: ... + 5 IU/mL Deoxyribonuclease I (#D4527, Sigma-Aldrich) + 0.1% RNasin Plus RNase Inhibitor (#N2618 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 U/mL DNase I (Sigma, DN25-100MG) in 1 mL of 1× PBS (Gibco ...
-
bioRxiv - Biophysics 2021Quote: ... with DNase I stock solution containing 5 mg/ml (=10.000 Kuntz Units/ml) DNase I (DNase I, D5025-150KU, Sigma) in 0.15 M NaCl (A2942 ...
-
bioRxiv - Cell Biology 2019Quote: ... Some PAs were treated with XE991 (3·10-8-3·10-6, Sigma) before the stimulation with 5-HT and then the relaxation induced by SNP was tested.
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 7×10−3 mM hypoxanthine (Sigma-Aldrich, St. Louis, MO) at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... accumulation was assessed by measuring the levels of the oxidized form of the cell-permeant 5-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate (DCFDA) (Sigma). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were irradiated using 8 J/m2 UV and labelled for 7 hours with 20 µM 5-Ethynyl-2’-deoxyuridin (EdU) and 1 µM Floxouridine (Sigma). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... Plates were incubated at 37 degrees C in 5% CO2 for 7 days before fixing with 2% formaldehyde and staining with 0.1% crystal violet (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2023Quote: ... The eluted M-protein fractions were collected in Eppendorf tubes prefilled with 5 μl 2 M TRIS.HCl (pH=7, Sigma Aldrich), to neutralize the solution ...
-
bioRxiv - Neuroscience 2021Quote: ... CAS # 7646-85-7 and ZnC4H6O4; CAS #557-34-6) and arsenic (NaAsO2; CAS #7784-46-5) (all from Sigma-Aldrich, St Louis, MO). The metallic compounds were either dissolved in 30% (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were incubated for 18 h with 2 mM thymidine (Sigma, T1895), then released during 11 h ...
-
bioRxiv - Cell Biology 2021Quote: ... 18 mm round glass coverslips (Fisherbrand) were coated with 2% gelatin (Sigma), which was conjugated to FITC or TRITC (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were plated on 4-6 18 mm glass coverslips coated with fibronectin (50 nM, Sigma) and equilibrated in culture medium ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Microbiology 2022Quote: ... 5(6)-carboxyfluorescein (CF) was from Sigma. EM104 10ml glass syringes from Sanitex international.
-
bioRxiv - Genetics 2023Quote: ... Beads were then incubated in 400 μl of Benzo buffer containing 2,500 units of benzonase (Sigma-Aldrich) for 1 h at 4°C and washed three times in IP buffer ...
-
bioRxiv - Microbiology 2019Quote: ... the probes for ROS (2’,7’-dichlorofluorescein diacetate, Sigma) and RNS (dihydrorhodamine 123 ...
-
bioRxiv - Immunology 2022Quote: ... 2% v/v of 7% w/v BSA (Sigma) and 1 μg/ml tosyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Hydrogel was prepared separately as solution I and II: Solution I was prepared by dissolving 8 g (16% (wt/vol)) paraformaldehyde (Sigma-Aldrich, Steinheim, Germany) (PFA ...
-
bioRxiv - Microbiology 2021Quote: ... epithelial cells were treated 16-18 h prior to infection in growth media containing 200 µM 2,2’-dipyridyl (DPI, Sigma-Aldrich), 200 µM DPI and 200 µM ammonium iron (III ...
-
bioRxiv - Microbiology 2022Quote: ... Peroxidase activity was revealed by incubating slides in 3-amino-9-ethylcarbazole (AEC) (Sigma) for 10 minutes ...
-
bioRxiv - Immunology 2022Quote: ... and developed using a filtered solution of 0.2mg/mL 3-amino-9-ethylcarbazole (Sigma) and 0.015% H2O2 (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... 1000 μM Indole-3-acetic acid sodium salt (IAA, Sigma Aldrich, #6505-45-9) was solubilized in RNase-free water (Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 1000 μM Indole-3-acetic acid sodium salt (IAA, Sigma Aldrich, #6505-45-9) was solubilized in RNase-free water (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 12-16 week old mice were administered 5 mg tamoxifen (Sigma) in corn oil on alternate days for a total of four intraperitoneal injections ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 % CO2 at 37 °C were seeded on Seahorse microplates pre-coated with 3 μg/mL collagen I (C9791, Sigma Aldrich) in 0.1 M acetic acid and allowed to adhere for at least 12 h ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 µm 6,7-Dinitroquinoxaline-2,3(1H,4H)-dione (DNQX, Sigma-Aldrich, D0540) were used to isolate mEPSCs or mIPSCs ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...