Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 2’,7’-Dichlorofluorescin diacetate (H2DCFDA) were procured from Sigma-Aldrich, USA ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.5 mg/mL 5(6)-Carboxyfluorescein diacetate (Sigma) was applied to the cut using a P2 pipette ...
-
bioRxiv - Biophysics 2021Quote: ... and 5(6)-carboxyfluorescein were purchased from Sigma-Aldrich. Methanol (LC/MS grade ...
-
bioRxiv - Biochemistry 2021Quote: ... G6PD (1M 6-aminonicotinamide, Sigma, Cat#329-89-5), PKM (20μM Compound 3K ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μM 6-azauridine (catalogue no. A1888; Sigma-Aldrich), 5 μM HCQ (catalogue no ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Cell Biology 2021Quote: Young mated female adults were fed with dry active yeast for 16∼18 hours and then dissected in Halocarbon oil 700 (Sigma-Aldrich, Cat# H8898) as previously described 15 ...
-
bioRxiv - Microbiology 2021Quote: ... with 7·5/1·875 mg/kg levodopa/carbidopa (D9628/C1335, Sigma), 0·15 mg/kg ropinirole (R2530 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-7 dpf larvae were anaesthetized in 0.01% chilled tricaine (Sigma-Aldrich) and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Microbiology 2020Quote: ... #9 (Sigma, #70050), #135 (AldrichSelect #361173301) ...
-
bioRxiv - Developmental Biology 2021Quote: Larvae at 2-6 dpf were first anesthetized with 0.03 % Ethyl 3-aminobenzoate methane sulfonate salt (Sigma-Aldrich, St. Louis, MO, USA) and pinned onto a Sylgard-filled recording chamber (I-2450 ...
-
bioRxiv - Cell Biology 2023Quote: The CCl4 model of cirrhosis was prepared as previously described.23 Male C57Bl/6 mice were treated three times a week for 18 weeks with 0.1 ml of 40% CCl4 (Sigma) in olive oil by oral gavage.
-
bioRxiv - Cell Biology 2019Quote: ... and 500 μM auxin (3-indole-acetic acid, IAA, Sigma, I-5148) for optimal depletion of SAF-A-AID-mCherry.
-
bioRxiv - Cell Biology 2020Quote: ... 10µM of CK-666 (Arp2/3 Complex Inhibitor I, 10µM, Sigma-Aldrich), ML141 (Cdc42 inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... Fixed brains were embedded in 3% Type I-B agarose (Sigma-Aldrich) and sliced into four series of 50μm thick coronal sections using a Compresstome (VF-700 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fixed brains were embedded in 3% Type I-B agarose (Sigma-Aldrich) and sliced into four series of 50μm thick coronal sections using a Compresstome (VF-700 ...
-
bioRxiv - Cell Biology 2021Quote: Perfluorononanoic acid (PFNA, 97%), 3-Isobutyl-1-methylxanthine (IBMX, ≥ 99%) and 2’,7’-dichlorofluorescin diacetate (DCFH-DA, ≥ 97%) were obtained from Sigma-Aldrich (St. Louis, MO, USA). JC-1 Mitochondrial Membrane Potential Detection Kit and MitoView™ Green were purchased from Biotium (Hayward ...
-
bioRxiv - Plant Biology 2020Quote: 20 mg of acridine orange hemi (Zinc chloride) salt (A6014, Sigma Aldrich, St. Louis, MO, USA) dye was placed in 50 ml distilled water and stirred for 60 min ...
-
bioRxiv - Microbiology 2022Quote: ... were incubated with 15 μg/ml TRITC-transferrin or 100 μg/ml acridine orange (A6014, Sigma) in serum free medium during 15 min at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were incubated in culture medium for 1-16 hours with 25μM Nutlin-3 (Sigma), 25μM anacardic acid (EMD Millipore) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antibody-bound chromatin was recovered after incubation for ~7 h at 4°C with Magna ChIP Protein A + G Magnetic Beads (16–663, Millipore). Beads were washed twice with Low salt buffer (0.1% SDS ...
-
bioRxiv - Neuroscience 2022Quote: ... Lysolecithin (LPC)-induced demyelination experiments were carried out in cerebellar slices from P11 animals at day 7 in vitro by incubation for 16 h with 0.5 mg/ml LPC (Sigma-Aldrich) (Birgbauer et al. ...
-
bioRxiv - Genomics 2021Quote: Fresh nuclei were incubated for 3 minutes at 37°C with limiting concentrations of the DNA endonuclease deoxyribonuclease I (DNase I) (Sigma) in buffer A supplemented with Ca2+ ...
-
bioRxiv - Plant Biology 2021Quote: ... medium, containing 3% sucrose, 10−6 M potassium indole acetate (Nacalai Tesque, Kyoto, Japan) and 10−5 M kinetin (Sigma, St. Louis, MO) at 25 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 24h post-plating the cardiomyocytes were fed with fresh medium supplemented with 2% FCS and with 10-5 M Isoproterenol (Sigma I-2760). To induce proliferation ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected with 6 μg of pCG1_SARS-2_S using X-tremeGENE 9 DNA transfection reagent (Sigma-Aldrich). Twenty hours later ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of 6-OHDA in 0.01% ascorbate (Sigma–Aldrich) into the median forebrain bundle (MFB ...
-
bioRxiv - Neuroscience 2023Quote: ... 2,2’-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS, Sigma-Aldrich) substrate was added to each well ...