Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and 1x each of phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates were incubated for 1 hour using over-end rotation ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1x each of phosphatase inhibitor cocktails 2 and 3 (Sigma)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Each eye received 2-3 30 nL-drops of CoCl2 (Sigma) at the indicated dose ...
-
bioRxiv - Immunology 2023Quote: ... Erythro-9-(2-hydroxy-3-nonyl) adenine (EHNA) (#E114; Sigma-Aldrich) was used to inhibit ADA1 activity ...
-
bioRxiv - Bioengineering 2023Quote: ... with 2 v/v% 3-(trimethoxysilyl) propyl methacrylate) (TMSPA, Sigma-Aldrich). These modifications allowed for easy manipulation of the crosslinked hydrogels ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2% (v/v) phosphatase inhibitor cocktail 3 (P0044; Sigma Aldrich). Triton-X100 (X100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, P5726 and P0044) and protease inhibitor cocktail (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μM PD0325901 (Selleckchem S1036) and 3 μM CHIR9902 (Sigma SML1046) 61 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μM 4-hydroxy tamoxifen (4-HT; Sigma) was added at the time of activation.
-
bioRxiv - Biophysics 2023Quote: ... the acrylate functionalized photodegradable monomer was synthesized by suspending 4-[4-(1-hydroxyethyl)-2-methoxy-5-nitrophenoxy]butyric acid (0.0166 mol, Sigma-Aldrich) in anhydrous DCM (90 mL) ...
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Microbiology 2021Quote: 5-aza-2’-deoxycytidine (5-AzadC, A3656) and epigallocatechin-3-gallate (EGCG, E4143) were purchased from Sigma Aldrich. Antibodies against CREB (sc-186) ...
-
bioRxiv - Neuroscience 2021Quote: ... a mouse monoclonal anti-chondroitin sulfate antibody (clone CS-56, 1:500 for Experiment 1 and 3 or 1:1000 for Experiment 2, C8035, Sigma Aldrich) specific for the glycosaminoglycan portion of the chondroitin sulfate proteoglycans that are the main components of the PNN and a polyclonal rabbit anti-parvalbumin antibody (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Genomics 2021Quote: ... 10 mM MgCl2,10 mM Tris pH 7.4, 1 mM CaCl2) with increasing amounts (0, 0.5, 1, 2, 5, 7.5, 10 U) of MNase (Sigma) at 30°C for 10 min ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 4 mM 5-bromo-4-chloro-3-indolyl α-D-N-acetylneuraminic acid (Sigma) was added ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was supplemented with a mixture of 3 branched-chain fatty acid precursors (100 μm of 2-methyl-butyrate, isobutyrate and isovalerate, Sigma-Aldrich) or straight fatty acid precursors (100 μm of methyl-butyrate ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µM 5-fluoro-2′-deoxyuridine (FldU, Sigma-Aldrich) were added to the cells ...
-
bioRxiv - Microbiology 2021Quote: ... sporozoites were added to 1 ml molten 3% agarose (2-Hydroxyethyl agarose – Sigma-Aldrich, dissolved in ddH2O), centrifuged and incubated at 4°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... For cell treatments the following compounds were used: 2′,3′-Dideoxycytidine (1-10 μM, Sigma-Aldrich®), Ethidium bromide (50 ng/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); Ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Developmental Biology 2020Quote: ... Phosphopeptide standards (0.1 pmol of MS PhosphoMix 1, 2, 3 Light; Sigma-Aldrich, St. Louis, Missouri, USA) was added to suspended sample in binding/equilibration buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... coli polar lipids (Avanti, US) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma Aldrich) in a 3:1 molar ratio ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Molecular Biology 2021Quote: ... X0-3 and X0-4 oligonucleotides (Sigma-Aldrich) in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µM 4-hydroxytamoxifen (OH-Tam, Sigma Aldrich) was added to induce Cre-mediated recombination in the mouse Ctsd gene resulting in a premature stop codon ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 and 4 were custom made from Sigma in the pLKO.1-Puro-CMV-tGFP vector backbone ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 ng/mL human NT-3 (Sigma-Aldrich), and 1 μg/mL laminin (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4-methylcyclohexanol (CAS #589-91-3, Millipore Sigma), pentyl acetate (CAS #628-63-7 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM glyceraldehyde-3-phosphate (G3P; Sigma-Aldrich), 4 mM nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Cell Biology 2020Quote: ... DAPI (4’,6-Diamidino-2-phenylindole dihydrochloride, 1:200, Sigma-Aldrich) staining was performed to visualize nuclei ...
-
bioRxiv - Bioengineering 2019Quote: ... together with 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) for localization of cell nuclei ...
-
bioRxiv - Biophysics 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Sigma, 1:500 dilution) was applied for 30 min followed by washes in PBS (3 × 10 sec) ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1:1000 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich), for 3h ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:200, Sigma-Aldrich) in the dark for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma, #H0887) and 100 U/ml penicillin/100 μg/ml streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma, #H0887) and 100 U/ml penicillin/100 μg/ml streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4',6-Diamidino-2-phenylindole (DAPI, Sigma, D9542, 1:1000). After incubation with secondary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindol (DAPI, Millipore, 1:5000) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:1000; Sigma-Aldrich) at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate-toluoidine were from Sigma-Aldrich, St ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min at 14,000 rpm at 4°C (Sigma 3-KIS centrifuge). Samples were snap-frozen in liquid N2 and delipidated by protein precipitation based on the protocol of Wessel and Flügge (61) ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...