Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Microbiology 2019Quote: ... and alternative NADH dehydrogenase inhibitor flavone (2-Phenyl-4H-1-benzopyran-4-one, 2-Phenylchromone, Sigma-Aldrich) (Martins et al ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mM Ca(NO3)2 ×24H2O (13477-34-4, Sigma), 2.5 mM KH2PO4 (7778-77-0 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% methyl cellulose (Sigma-Aldrich), 1% pen/strep antibiotics and 1% NEAA ...
-
bioRxiv - Neuroscience 2022Quote: ... for 3-4 hours> Primary antibodies: Rabbit-α-GluA1 (Sigma-Aldrich AB1504, 1:300) and Mouse-α-bassoon (Abcam ab82958 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Bioengineering 2021Quote: ... 3- [(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Sigma RES1300C), digitonin (Sigma D141) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mg/ml 3′,3′-diaminobenzidine tetrahydrochloride hydrate (Sigma), 24 units/ml catalase from bovine liver (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... and cargo in a 1:4:1 ratio with PEI reagent (1:3 plasmid to PEI ratio, Sigma). Three days after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... DHEA sulfate (5-androsten-3β-ol-17-one-3-sulfate) and testosterone (4-androsten-17β-ol-3-one) were purchased from Sigma Aldrich. 11β-hydroxyandrostenedione (11β-hydroxy-4-androstene-3,17-dione) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (ammonium salt) (PI(4,5)P2) (Sigma 850155P), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC ...
-
bioRxiv - Genomics 2024Quote: Isopentane (2-methyl butane; EMD Millipore/MilliporeSigma, cat. no. MX0760-1)
-
bioRxiv - Biochemistry 2023Quote: ... Irgacure 2959 (2-Hydroxy-4′-(2-hydroxyethoxy)-2-methylpropiophenone) were purchased from Sigma Aldrich for preparation of crosslinked polymer.
-
bioRxiv - Biophysics 2021Quote: NmeCas9 was expressed in Rosetta 2(DE3) cells (Millipore Sigma, 71400-3) and grown in LB supplemented with 100 µg/mL Carbenicillin and 34µg/mL Chloramphenicol ...
-
bioRxiv - Immunology 2019Quote: ... the MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) powder is re-suspended into PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Phosphatase Inhibitor Cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO) and MiniComplete Protease Inhibitor Cocktail (Roche Diagnostics) ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Sigma-Aldrich) for the MTT assay was dissolved in PBS in stock concentration 5 mg/mL and stored at 4 °C in the dark ...
-
bioRxiv - Neuroscience 2022Quote: 2’-3’-dideoxycitidine (ddC) was purchased from Sigma Aldrich (St. Louis, MO). AM1710 was synthesized by the lab of Alexandros Makriyannis (Northeastern University ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing phosphatase inhibitor cocktails 2 and 3 and protease inhibitors (Sigma-Aldrich), for 30–45min at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 400μL (3 mg/mL) of methylbenzothiazolinone-2-hydrazone (MBTH, Sigma M8006−1G), 200μL of sample and 0.5μI of alcohol oxidase (E.C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Genetics 2020Quote: ... 137.14 mg of 2-methylpyridine-3-carboxylic acid (Sigma Aldrich, cat. 325228) were resuspended in 500 μl DMSO anhydrous (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2 mg/ml N-(3-dimethylaminopropyl)-N′- ethylcarbodiimide hydrochloride (Sigma, 03450) in 50 mM HEPES] for 30 min on slow agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitors (cocktail 2; P5726; and cocktail 3; P0044; Sigma-Aldrich). Lysates were incubated for 5 min at 100 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, P5726 and P0044). Homogenized sample was left incubating for disulfide bond reduction for 60 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: Spheroids were treated every 2-3 days with either GSK343 (Sigma-Aldrich), GSK126 (Selleckchem) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.05 mM (1,4-di [3’-(2’-pyridyldithio)propionamido] butane) (DPDPB, Sigma 16646) in PBS for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 and 3 inhibitor (Glutor, 0.05, 0.1, and 0.25 µM, Sigma, SML2765) for 6 to 72 hours ...
-
bioRxiv - Neuroscience 2023Quote: 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium (MTT) (Millipore Sigma) is converted to water-insoluble product formazan by reduction at mitochondrial complex II of the electron transport chain ...
-
bioRxiv - Biochemistry 2024Quote: ... exponentially growing TriEx cells (3 mL suspension, 2×106 cells/mL, Novagen) in serum-free Insect-XPRESS medium (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... Mice were anesthetized by exposure to 2% to 3% isoflurane (Sigma-Aldrich) for 5 to 10 minutes and intranasally infected with 40 μL of a suspension containing 105 spores for the leukopenic model and 106 spores for the corticosteroid model ...
-
bioRxiv - Microbiology 2024Quote: ... and media was replaced every 2-3 days with MEME medium (Sigma), supplemented with 2 mM L-Glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 ml of fresh neuron culture media containing 1 μM 4-hydroxytamoxifen (4-OHT; Sigma H6278) was added into each well of neuron culture ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 the cell culture media was replaced 1-2 hours before imaging with RPMI media (Sigma-Aldric R8755) supplemented with B27 ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately1-2 μL of endotoxin-free DNA (1-3 mg/ml) diluted in PBS/0.025% Fast Green (SIGMA) was injected into the lateral ventricles of the forebrain using heat-pulled glass micropipettes (Drummond) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pellet was resuspended and incubated for 30 min at 4 °C in buffer B (10 mM Tris pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% Glycerol, 1 mM DTT, Sigma cOmplete EDTA-free Protease Inhibitor Cocktail) ...
-
bioRxiv - Biochemistry 2023Quote: ... and phosphatase inhibitors (prepared in-house according to Phosphatase inhibitor cocktail 1, 2 and 3 from Sigma-Aldrich)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma, 1:2000 in 1× PBS) for 5’ and mounted with fluorescent mounting medium (Dako) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), Tim23 (BD Transduction Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), HSP60 [LK1] (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Immunology 2023Quote: ... and/or 4 μM N,N,N’,N’-tetrakis-(2-pyridyl-methyl)-ethylenediamine (TPEN; Sigma, #P4413) was added to the cells ...
-
bioRxiv - Biophysics 2022Quote: ... HEPES (2-[4-(2-hydroxyethyl)piperazin-1-yl] ethanesulfonic acid) was purchased from EMD Millipore (Billerica, MA USA) and NaCl (sodium chloride ...