Labshake search
Citations for Millipore Sigma :
4901 - 4950 of 5860 citations for QuantiChrom Hemoglobin Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2019Quote: ... Size of the PCR products was verified by gel electrophoresis and purified using an Amicon Ultra 0.5 ml kit (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... PLA was performed according to the manufacturer’s recommendation (Duolink™ In Situ Red Starter Kit Mouse/Rabbit, Sigma-Aldrich). Primary antibodies against GFP (ab13970 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... using ortho-nitrophényl-β-galactoside as substrate (β-Galactosidase Reporter Gene Activity Detection Kit, Sigma St Louis MI USA).
-
bioRxiv - Neuroscience 2019Quote: ... Total protein staining solution (REVERT Total Protein Stain kit, LI-COR Inc., # 926-11010; Pyronin Y (Sigma-Aldrich # P9172)
-
bioRxiv - Cell Biology 2021Quote: Senescence-associated β-galactosidase (SA-β-gal) activity was determined with the Senescence Cells Histochemical Staining Kit (Sigma-Aldrich). Six representative images were captured on a TS100 inverted light microscope (Nikon ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from apple leaves with the Spectrum Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO). Two micrograms of total RNA were treated with DNAse (Ambion ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from leaves using the GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA). The integrity of the DNA was verified by electrophoresis on a 1% agarose gel stained with ethidium bromide ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated in an endotoxin-free manner (GenElute™ HP Endotoxin-Free Plasmid Maxiprep Kit; Sigma-Aldrich) and concentrated using paramagnetic beads (HighPrep PCR Clean Up System ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNAs were isolated from young buds or leaves using the Spectrum™ Plant Total RNA Kit (SIGMA-ALDRICH). Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Metabolite peaks were confirmed using the mass spectrometry metabolite library kit MSMLS-1EA (Sigma Aldrich supplied by IROA Technologies).
-
bioRxiv - Immunology 2020Quote: ... PCRs for genotyping of bacterial colonies after transformation were performed using the KAPA2G Fast ReadyMix kit (Sigma Aldrich, #KK5102) with custom designed primers and the following cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: Bacterial DNA was isolated and purified with the GenEluteTM Bacterial Genomic DNA kit (Sigma-Aldrich, St. Louis, Missouri, USA). PCR was used for the identification of six virulence factor genes (fliL ...
-
bioRxiv - Plant Biology 2021Quote: RNA from frozen ground stem samples was extracted using a Plant Total RNA extraction kit (Sigma, St Louis, MO) with modifications to the kit protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid was purified using a Qiagen Maxi kit and resuspended in CytoMix (25 mM HEPES, pH 7.6, 2 mM EGTA (Sigma), 5 mM MgCl2 (Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PRC using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were fixed by 4% PFA and stained with warm TRAP staining solution (TRAP kit, Sigma-Aldrich, SLBW4002) for 10-30 min at 37°C27 ...
-
bioRxiv - Neuroscience 2022Quote: ... The membrane was hybridized with a digoxigenin-labeled DNA probe generated with a PCR DIG Probe Synthesis Kit (Sigma). Hybridization with a 5’ probe produced an 8.1 Kb band from the WT and a 5.1 Kb band from the targeted locus ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... DNA was purified from cells harvested at the indicated time points using a Mammalian Genomic DNA Miniprep Kit (Sigma). DNA was immobilized on nitrocellulose and analyzed by immunodot blotting with antibodies against cyclobutane pyrimidine dimers (CPDs ...
-
bioRxiv - Microbiology 2022Quote: The PCR products were inserted into the pET-30 Ek/LIC vector according to manufacturer’s instructions (LIC Kit, Novagen) (Table S2) ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was extracted from PBMCs using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA).
-
bioRxiv - Developmental Biology 2022Quote: The concentration of triglycerides in Drosophila larvae was measured using the Triglyceride Quantification Colorimetric Kit from Sigma (Cat. # MAK266). Ten ...
-
bioRxiv - Cancer Biology 2022Quote: The viability of THP-1 cells was assessed for 24h using the Cell Proliferation Kit II (XTT) (Sigma-Aldrich) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from sub-cultured isolates (loop of colonies) using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was crosslinked using UV light and hybridized with a DIG labelled probe (PCR DIG probe synthesis kit, Sigma). For detection of LbuCas13a the membrane was stripped and probed with DIG labelled Cas13a specific probe and signal detected on a Licor Odyssey imaging system (LI-COR Bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... YFP-dsRNA was labeled using the fluorescein RNA Labeling Mix Kit following the manufacturer’s instructions (Sigma, St. Louis, MO). For confocal microscopy examination of fluorescent dsRNA uptake by fungal mycelium ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids encoding the selected peptides were isolated in 96-well format using the Montage Plasmid MiniprepHTS Kit (MilliPore, LSKP09604) on a MultiscreenHTS Vacuum Manifold (MilliPore ...
-
bioRxiv - Neuroscience 2021Quote: ... Cytokines/chemokines were then quantified by multiplex immunoassay using a high sensitivity mouse multiplex magnetic bead kit (Millipore Sigma) and performed according to the manufacturer’s recommendations (MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel-Immunology Multiplex Assay ...
-
bioRxiv - Biochemistry 2020Quote: ... fixed and stained for β-galactosidase activity at pH = 6 using Senescence Cells Histochemical Staining Kit (Sigma, Cat#CS0030). For rescue assays ...
-
bioRxiv - Cell Biology 2021Quote: VCAM-1 in the media (1:100) from MCECs stimulated with MG was measured using commercial kits from Sigma, according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: Apoptotic cells in the lung were detected by immunohistochemistry using the ApopTag in situ apoptosis detection kit (EMD Millipore) following the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2021Quote: Plasma leptin levels were determined using a commercially available mouse leptin ELISA kit (EMD Millipore, St. Charles, MO, USA). The intra-assay variation of the kit was between 1.06-1.76% ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen tissue (from 2–3 mice or 1 rat) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... Pluripotency status of control and ABCF1-knockdown cells were analyzed using an alkaline phosphatase (AP) detection kit (EMD Millipore), or by RT-qPCR analysis of mRNAs purified using TRIzol reagent (Life Technologies).
-
bioRxiv - Immunology 2021Quote: ... and growth factors were quantified in plasma using a 23-plex MAP NHP immunoassay kit (PCYTMG-40K-PX30, Millipore) following the manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The PLA was conducted according to the manufacturer’s instructions using the Duolink In Situ Red Starter Kit Mouse/Rabbit (Cat. No. DUO92101, SIGMA). After blocking for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Cell Counting Kit-8 (CA1210) and D-Luciferin (L6882) were all purchased from Sigma-Aldrich (Saint Louis, MO, USA). Lipofectamine2000 was purchased from Invitrogen (11668019 ...
-
bioRxiv - Immunology 2022Quote: RNA extraction of freshly isolated cells in BAL or detached AMs was performed using total RNA purification kit (Sigma) together with DNase I (invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The protein supernatants were collected after centrifugation at 30,000g at 4 °C for 30 min and then quantified using a 2D-quant kit (Sigma). For each diagnostic group ...
-
bioRxiv - Genetics 2019Quote: ... 50 uL of PCR product of each sample was purified with SpinPrep PCR Clean-Up Kit (EMD Millipore Corp) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... the recovered nuclear pellet was extracted as for broccoli nuclei using Nuclear Extraction Buffer (CelLytic PN kit, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2019Quote: ... Further staining of primary antibody was performed following Dako envision plus kit and DAB staining (Anti-ITGA2, Sigma HPA063556). Hematoxolin and eosin staining was performed following dehydration of the tissue by incubation with increasing concentrations of alcohol ...
-
bioRxiv - Genetics 2019Quote: ... the tagmented DNA was amplified by PCR using the KAPA2G Robust PCR kit (Sigma-Aldrich, St. Louis, MO, USA) using the GC buffer along with 0.2 μM of each custom P5 and P7 indexing primers (File S1 ...
-
bioRxiv - Biochemistry 2019Quote: The medium of stimulated 3T3-L1 adipocytes was collected and glycerol content measured using a standard glycerol kit (Sigma). Cells were washed three times with 1xPBS and lysed by incubation with 0.3 M NaOH and 1% SDS ...
-
bioRxiv - Microbiology 2019Quote: ... each RNA sample was supplemented with 1 unit of DNase I (from the DNA amplification grade Kit of Sigma) per µg of RNA and incubated at room temperature for 10 min ...
-
bioRxiv - Pathology 2020Quote: ... Adiponectin was measured in the samples using MILLIPLEX Mouse Cytokine/Chemokine 1-plex kit (Millipore, St. Charles, MO, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... 200 μL of incubation media was removed and kept to measure glycerol and FA release using commercial kits (Sigma-F6428 and Wako diagnostic NEFA-HR ...
-
Potential of host serum protein biosignatures in the diagnosis of tuberculous meningitis in childrenbioRxiv - Immunology 2019Quote: All biomarkers were evaluated following the instructions of the respective kit manufacturers (R&D Systems and Merck Millipore, respectively) in a blinded manner ...