Labshake search
Citations for Millipore Sigma :
4851 - 4900 of 10000+ citations for IL 3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the cells were blocked in 3% bovine serum albumin (BSA)(Sigma-Aldrich) in TBS containing 0.05% Tween 20 (0.05% TBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were resuspended in PBS supplemented with 3% fetal bovine serum (Sigma) and quantified manually under a phase-contrast microscope ...
-
bioRxiv - Neuroscience 2020Quote: ... Fixed brains were embedded in 3% Type I-B agarose (Sigma-Aldrich) and sliced into four series of 50μm thick coronal sections using a Compresstome (VF-700 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signature 3 status was determined using the category classification output by SigMa; however ...
-
bioRxiv - Bioengineering 2020Quote: ... were silanized by coating with 3-(trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich). Both methods of surface modification were applied to 1” x 3” glass slides (VWR) ...
-
bioRxiv - Bioengineering 2020Quote: ... for 3 h and induced by 1 mM IPTG (Sigma-Aldrich, USA) overnight ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM MgCl2) supplemented with complete Protease inhibitor cocktail tablets (Sigma-Aldrich). The lysates were incubated on ice for 1 hour and centrifugated at 20,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Inverse transfections were conducted as follows: 3 µL GeneJuice® (Merk Millipore) was added dropwise to 100 µL Opti-MEM (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were quickly washed 3 times with TBS/T (0.1% Tween20, Sigma #P5927 ...
-
bioRxiv - Neuroscience 2021Quote: ... GluK2/3 (rabbit, Millipore, 04-921, WB 1:4000, IF 1:500), Homer (guinea pig ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3) mouse anti-NeuN (mouse monoclonal, Millipore, cat # MAB377, 1:100); and mouse anti-S100β (Sigma S2532 ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue was infiltrated using 3:1 acetone to Durcupan resin (Sigma Aldrich) for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: Auxin plates were prepared by adding auxin Indole-3-Acetic Acid (Sigma) from a 400 mM stock solution in ethanol into NGM at the final concentration of 1 mM (Zhang et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated for 30 min in PBS containing 3% H2O2 (Sigma). Following quenching ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA was stained with 20 μM Hoechst 33342 (Sigma, #23491-52-3) and coverslips were mounted on glass slides with Mowiol 4-88 (Calbiochem ...
-
bioRxiv - Cancer Biology 2020Quote: ... After washing and saturation with 3% BSA (Bovine Serum Albumin; Sigma, #A7906) / PBS (Phosphate Buffered Saline ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing fresh 200 mM DL-Dithiothreitol (Cat.#3483-12-3; Sigma-Aldrich). For the majority of samples 5 µg total protein could be loaded ...
-
bioRxiv - Biochemistry 2020Quote: ... spiked with 1 μM 1,2-didecanoyl-sn-glycero-3-phosphocholine (Sigma-Aldrich) as internal standard ...
-
bioRxiv - Neuroscience 2021Quote: The microfluidic chip was then coated with (3-aminopropyl)triethoxysilane (Sigma Aldrich) and glued to MEA with EPO-TEK 301-2FL (Epoxy Technology ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were derivatized with N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (Sigma-Aldrich, 1.0 mg per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Phosphatase Inhibitor Cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO) and MiniComplete Protease Inhibitor Cocktail (Roche Diagnostics) ...
-
bioRxiv - Immunology 2019Quote: ... The plates were washed and then blocked with 3% BSA (Sigma-Aldrich) in PBS Tween-20 (PBS-T20 ...
-
bioRxiv - Neuroscience 2020Quote: ... then were pretreated with TRIS containing 1-3% bovine serum albumin (Sigma) and 0.1-0.3% Triton-X depending on the detectable target protein ...
-
bioRxiv - Physiology 2020Quote: ... and were purchased from Sigma-Aldrich (see Table 3 for primer details). All reactions were performed in duplicate on 384-well MicroAmp optical plates (Applied Biosystems ...
-
bioRxiv - Biophysics 2020Quote: ... and 1 μg/μL Laminin (3 h at 37°C) (Sigma Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... 20 μL of aqueous 3% H2O2 solution (Sigma-Aldrich, St. Louis, MO) was then pipetted onto 6-mm diameter disk ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX) (Sigma, Germany #28822-58-4). After 48 h the induction medium was replaced by the differentiation medium containing DMEM/Ham’s F12 ...
-
bioRxiv - Biophysics 2020Quote: ... We let the coverslips dry and added (3-aminopropyl) triethoxysilane (APTES, Sigma) to their treated sides afterwards ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Sigma-Aldrich) for the MTT assay was dissolved in PBS in stock concentration 5 mg/mL and stored at 4 °C in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 μM Arp2/3 inhibitor CK-666 (MERCK Millipore, #182515-25MG) both confined and unconfined cells were incubated with the drugs for two hours before imaging was started ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tissue sections were then incubated in blocking buffer [3% Goat Serum (Sigma), 1% Bovine Serum Albumin (Sigma) ...
-
bioRxiv - Systems Biology 2022Quote: ... Vancomycin (Sigma Aldrich, Louis, MO, USA; 0, 3, 10, 30, 100 µM) was incubated with EPEC strains at 37?C ...
-
bioRxiv - Microbiology 2022Quote: ... Suspensions were then incubated with 3% w/v mutanolysin (Sigma-Aldrich, M9901) for 1 hour at 370C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 16.7mM glucose + 100μM 3-isobutyl-1-methyl-xanthine (IBMX, Sigma, Cat #: I5879), 16.7mM glucose + 20mM Arginine/HCl (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Biotin 3-sulfo-N-hydroxysuccinimide ester (1 mg/mL; Sigma, Cat# B5161) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Virus amplification was performed in Sf9 TriEX cells (Novagen / Merck #71023-3) grown in TriEx media (Novagen / Merck #71022) ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed 3 times in 1X Phosphate Buffered Saline (PBS, Sigma-Aldrich, P5493) and stored at 4°C in PBS supplemented with 0.1% Sodium Azide (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... Following 3 washes with TBS-t membranes were developed with Luminol (Sigma) in the ImageQuant LAS4000 system ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3 mL LB starter culture with 100 μg/mL carbenicillin (Sigma) was prepared from a single fresh colony and grown for 4 hours at 37° C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Inactivation of endogenous peroxidases was carried out using 3% hydrogen peroxide (Sigma) for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The lysate was then treated with Benzonase nuclease HC (#71206-3, Millipore) for 45 minutes at 37 oC ...
-
bioRxiv - Pathology 2022Quote: ... The lysate was then treated with Benzonase nuclease HC (#71206-3, Millipore) for 45 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3% dextran (Leuconostoc spp, Mr 450,000-650,000, Sigma-Aldrich, St. Louis, MO) in PBS (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: 2’-3’-dideoxycitidine (ddC) was purchased from Sigma Aldrich (St. Louis, MO). AM1710 was synthesized by the lab of Alexandros Makriyannis (Northeastern University ...
-
bioRxiv - Biochemistry 2022Quote: ... The second layer was coated with 3-aminopropyl trimethoxysilane (Sigma-Aldrich, USA) for 2 h ...
-
bioRxiv - Biophysics 2022Quote: ... Anti-YB-3 (Anti-YBX3 antibody produced in rabbit, HPA034838, Sigma-Aldrich) and Anti-HuR (antibody produced in mouse (3A2) ...
-
bioRxiv - Cell Biology 2022Quote: ... drug selection was performed with 3 μg/mL puromycin (Sigma-Aldrich, P8833). Puromycin-resistant cells were passaged 3 times and then sorted by flow cytometry (Sony ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.