Labshake search
Citations for Millipore Sigma :
4751 - 4800 of 10000+ citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... and 6 mg/ml bovine serum albumin (BSA; Sigma-Aldrich) for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... Clozapine (6 mg/kg, 10 ml/kg, i.p.; Sigma-Aldrich) was dissolved in 0.1 M hydrochloric acid ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were dissociated every 6 days with Accutase (Sigma-Aldrich) and plated at 150,000 cells/mL ...
-
bioRxiv - Bioengineering 2019Quote: ... but containing 1.5 mg/mL 6-aminocaproic acid (ACA; Sigma), was added ...
-
bioRxiv - Cell Biology 2019Quote: ... in the presence of 6 μg/mL Polybrene (Sigma-Aldrich). The same procedure was used to produce the double expressing H2B-GFP and mRFP-CLASP2γ cell lines.
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Neuroscience 2020Quote: Cell culture inserts for 6-well plate (Merck Millipore, #044003)
-
bioRxiv - Biochemistry 2020Quote: ... An empty 6 mm antibiotic assay filter disc (Merck-Millipore) was then placed in the centre of the lawn and 10 μl of 1 M NaN3 was pipetted onto the filter disc ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... followed by 6 h digestion with 0.75% H2O2 (Sigma-Supelco), then diluted in ultrapure water and analyzed ...
-
bioRxiv - Biochemistry 2021Quote: 6-gingerol was purchased as a powder from Sigma-Aldrich Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... 6 μM Ceapin-A7 (CP7) (Sigma-Aldrich, Cat. No. SML2330) was added to cells ...
-
bioRxiv - Biochemistry 2022Quote: ... or glucose-6-phosphate dehydrogenase (G6PD) (Sigma Cat#A9521-1VL) (1:20,000) ...
-
bioRxiv - Microbiology 2022Quote: ... solid media was supplemented with 6 mM caffeine (Sigma, C0750) or 5 nM rapamycin (Sigma ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The reaction was quenched with 6 mM bathophenanthroline (Sigma 133159), followed by 2xSTOP buffer (10 mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: ... EDM was further supplemented with 10−6 M hydrocortisone (Sigma), 100 ng ml−1 human SCF ...
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Developmental Biology 2022Quote: 6 dpf larvae were anesthetised with tricaine (MS-222, Sigma), embedded in 1% low-melting point agarose (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2020Quote: ... Nonspecific biding was blocked by 6% bovine serum albumin (Sigma) for 30 min at room temperature and cells were washed in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 µM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX; Sigma) and 40 µM D(−)-2-amino-5-phosphonovaleric acid (APV ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2022Quote: ... or 6 hrs with α-amanitin (30 μg/ml, Sigma) before fixation for 20 min in 4% PFA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Butyrate stock solution (Sigma Aldrich CAS no. 107-92-6) was prepared in ultra-pure water at a concentration of 100 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-glucose-6-phosphate dehydrogenase (G6PDH, Sigma-Aldrich A9521) 1:50,000 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Chinese hamster ovary (CHO) cells (Sigma, passage 6 to 20) were chosen for this study due to the absence of endogenous ASIC-like currents [53] and were grown using standard procedures in the following medium ...
-
bioRxiv - Neuroscience 2019Quote: ... fructose-6-phosphate and other chemicals were from Sigma-Aldrich. ADP detection system (ADP-Glo ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Pathology 2020Quote: ... sodium phosphate (Sigma Aldrich, 7782-85-6, St. Louis, MO), sodium chloride (BDH ...
-
bioRxiv - Neuroscience 2019Quote: ... 250µL of 6% (w/v) carmine red dye (Sigma-Aldrich) in 0.5% (w/v ...
-
bioRxiv - Neuroscience 2021Quote: ... and unilaterally injected with 6-OHDA (Sigma-Aldrich A/S) (2 µl of 7 µg/µl free base in saline containing 0.02% ascorbic acid ...
-
bioRxiv - Microbiology 2021Quote: ... and supplemented with 6% inactivated fetal calf serum (iFCS, Sigma). The human macrophage-like cell line U937 (ATCC no ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2009.) and were resuspended in 6 M Guanidine HCl (Sigma cat# G3272-1KG ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... the synthetic single-stranded oligonucleotides (Sigma-Aldrich, Supplementary Table 6) were diluted in sterile water to 200 nM ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 6 mg/ml chicken egg white lysozyme (Sigma). Samples were incubated at 37°C for 30 minutes under shaking ...
-
bioRxiv - Cell Biology 2019Quote: ... or a cocktail of protease inhibitors: 6 µM Leupeptine (Sigma), 0.044 TUI/mL Aprotinine (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... PZ0233)– 10 μM in H2O (6) IRE1 inhibitor 4μ8c (Sigma, SML0949) – 64μM in DMSO (7 ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 6-(γ,γ-dimethylallylamino) purine (Sigma; Cat. No: D5912-5G) was used for calculation of standard curve.
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1, Sigma; 1:2000), GFP (Abcam ab13970) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 μM carbonyl-cyanide p-triflouromethoxyphenylhydrazone (FCCP) (Sigma-Aldrich C2920) and 4.5 μM Antimycin A (Sigma-Aldrich A8674) ...
-
bioRxiv - Bioengineering 2022Quote: ... the 6 wt.% gelatin solution (Porcine skin, Type A, Sigma) in deionized (DI ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma) and 50 μM D ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma) and 50 μM D,L-2-amino-5-phosphonovaleric acid (AP5 ...
-
bioRxiv - Genetics 2022Quote: ... myoblasts were incubated with 6 μM of 5AzadC (Sigma, A3656) for 24h ...