Labshake search
Citations for Millipore Sigma :
401 - 450 of 2489 citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Non-target scrambled shRNA (SHC002) was purchased from Sigma Aldrich. shRNA to human raptor (plasmid#1857 ...
-
bioRxiv - Cancer Biology 2022Quote: MLL1 was depleted using two separate shRNA constructs (Millipore Sigma):
-
bioRxiv - Neuroscience 2022Quote: ... and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...
-
bioRxiv - Microbiology 2022Quote: The shRNAs targeting human MARCHF8 were purchased from Sigma-Aldrich. The sgRNAs targeting mouse Marchf8 were designed by the web-based software ChopChop (http://chopchop.cbu.uib.no ...
-
bioRxiv - Genomics 2022Quote: We purchased lentiviral shRNA-expressing constructs targeting Twist2 (Millipore Sigma clone IDs TRCN0000086084 ...
-
bioRxiv - Cell Biology 2023Quote: ... The knockdown efficiencies of shRNAs were provided by Sigma-Aldrich using quantitative PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... MISSION pLKO.1 scrambled non-target shRNA SHC002 (Millipore Sigma) was used as a control for SNX17 knockdown constructs ...
-
bioRxiv - Biochemistry 2023Quote: MISSION TRC1.5 pLKO.1-puro Non-Mammalian shRNA Control (Sigma) was used as a control shRNA.
-
bioRxiv - Developmental Biology 2023Quote: ... The Mouse Ulk4 shRNA lentiviral vector was purchased from Sigma (TRCN0000328268 for Ulk4 knockdown in NIH3T3 cells and MEFs;TRCN0000002203 for Ulk4 knockdown in HEK293 cells) ...
-
bioRxiv - Biochemistry 2023Quote: ... or the pLKO.1-shRNA vector (Sigma Mission TRCN0000001418; ‘shDDR2’) using LipofectamineTM 2000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... pLKO.1 (Mission shRNA library from Sigma-Aldrich, see below), and the packaging vectors ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentiviruses expressing shGAN and shSCR have been described previously and were obtained from SIGMA MISSION shRNA systems: shGAN (MISSION® vector TRC # TRCN0000251146, Sigma) and shSCR (#SHC002 ...
-
bioRxiv - Neuroscience 2024Quote: ... TDP43-specific shRNA lentiviral clone (clone ID TRCN000016038, Sigma Aldrich) or SHC001 (shRNA Empty Vector Control Plasmid DNA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Immunology 2019Quote: shRNA’s were acquired from the Mission library (Sigma, Zwijndrecht, the Netherlands) and were kindly provided by (dept ...
-
bioRxiv - Neuroscience 2020Quote: ... The following lentiviruses were used for transduction: Mission shRNA vectors (Sigma) shNT (Non-Mammalian shRNA Control ...
-
bioRxiv - Cancer Biology 2020Quote: Validated siRNAs and lentiviral constructs expressing shRNAs were purchased from Sigma. Constructs for CRISPR/Cas9-mediated gene knockout (Cas9 and guide RNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... FOXO3A (TRNC0000010335, only clone validated by Sigma MISSION shRNAs, to date) and control (SHC002) ...
-
bioRxiv - Cancer Biology 2022Quote: Suppression of ABL1 was achieved using lentivirus-based shRNAs (Sigma Aldrich). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: shRNAs targeting ABCG2 were obtained from Sigma-Aldrich (product# SHCLNG-NM_004827). Viral supernatants were prepared by transfecting 293T cells with GFP- or ABCG-targeting shRNAs encoded in pLKO.1 vectors using X-tremeGENE 360 transfection reagent (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... The vectors encoding two different shRNAs targeting ERK5 were from Sigma (TRCN0000010262/pLKO.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A non-targeting shRNA (# SHC202) was also purchased from Sigma-Aldrich.
-
bioRxiv - Cell Biology 2020Quote: ... MDN1 and mouse Prmt1 were the validated MISSION shRNAs (Sigma-Aldrich). The shRNAs were TRCN0000290479 (human PRMT1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S3). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... controls pLKO (SHC001, no insert) and non-mammalian shRNA (Sigma; SCH002) in 293T cells using the third-generation lentiviral packaging system (10,11) ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs targeting the genes of interest were purchased from Sigma-Aldrich, including shRNAs targeting S100A11 (TRCN0000289926) ...
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S2). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 lentiviral constructs with shRNA was obtained from Sigma-Aldrich (MFN2-sh1:TRCN0000082684 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two different shRNAs for GMPS were used in this study (Sigma), shGMPS-41 ...
-
bioRxiv - Cell Biology 2022Quote: ... and with the indicated shRNA in the pLKO.1 vector (Sigma) using calcium phosphate precipitation ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1 lentiviral constructs with shRNAs were obtained from Sigma-Aldrich (shROCK ...
-
bioRxiv - Microbiology 2022Quote: ... BUD23 specific shRNAs or ORF11-GFP were treated with cycloheximide (Sigma) at 100 μg/ml for 3 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Induction of the shRNA was performed with doxycycline hyclate (Sigma Aldrich) at 2 µg/mL for 72 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... shRNA expression was induced using 1 µg/mL doxycycline (Sigma, D9891) for 72 h before seeding ...
-
bioRxiv - Genomics 2022Quote: ... Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID: TRCN0000255746) and cloned into the pLKO.5-puro lentiviral construct (Sigma SHC201) ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (TRCN0000013109; TRCN0000013108) and HSPA5 (TRCN0000001024) shRNAs were purchased from Millipore-Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1-puro-shRNAs-Vectors for Control (Sigma-Aldrich, #TRCN0000382379), LSD2 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were transduced with lentivirus of MISSION TRC1-shRNA (Sigma) knocking down candidate substrates at DIV4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... non-targeting shRNA control (shCtrl: SHC016) were purchased from Sigma-Aldrich. Tetracyclin (Tet ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg of an shRNA vector (pLKO.1-puro vector-Sigma), 2 µg pMD2.g ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: HemEC (n=3) were transduced with SOX18 shRNA lentivirus (TRCN0000017450, Sigma) or an empty vector control virus (Sigma SHC001V ...
-
bioRxiv - Cell Biology 2024Quote: ... we obtained a shRNA sequence targeting mouse ARG1 from Sigma-Aldrich Mission RNAi (TRCN0000101796) ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... The SLC25A1-specific shRNA vectors were purchased from Sigma (TRCN0000232825; TRCN0000255350) and validated before (6,18,24) ...
-
bioRxiv - Cancer Biology 2021Quote: ... rat IgG (Sigma), rabbit F(ab’)2 anti-mouse IgG conjugated to FITC (STAR9B ...
-
bioRxiv - Neuroscience 2022Quote: ... rat astrocytes (Sigma) were plated in a DMEM media (Thermofisher ...
-
Lineage, Identity, and Fate of Distinct Progenitor Populations in the Embryonic Olfactory EpitheliumbioRxiv - Developmental Biology 2021Quote: ... NCAM (Millipore, rat), and OMP (Pierce Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... non-targeting scrambled shRNA served as control (shc002, named shCtrl, Sigma-Aldrich). SMO-inhibitor resistant Daoy cells with shRNA-mediated knockdown of SUFU had been generated in our lab using the TRCN0000019466 construct (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pLKO.1-puro Non-Mammalian shRNA Control (Sigma#SCH002), pLKO.1-puro.shSLX4IP.1 ...
-
bioRxiv - Molecular Biology 2020Quote: Five MISSION shRNAs specific for each splicing regulator were purchased from Sigma in pLKO lentiviral vectors and their effects were compared with those of SHC002 mammalian non-targeting MISSION shRNA (Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...