Labshake search
Citations for Millipore Sigma :
251 - 300 of 2489 citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The shRNAs in pLKO.1-puro (MET MISSION Lentiviral Transduction shRNA particle) were commercially purchased from Sigma (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral shRNA constructs were derived from the pLKO.1-based TRC1 shRNA library (Sigma-Aldrich/RNAi Consortium); the following vectors were used ...
-
bioRxiv - Cell Biology 2021Quote: ... GBM#U3013 cells were infected with lentiviral particles generated by transfecting HEK293 cells with pLKO.1-puro plasmids from the Mission shRNA library (Sigma-Aldrich). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: For depletion of ATG14 and NOX2 virus particles were generated in HEK 293-T cells transfected with the control vector pLKO.1 (pLKO.1 non-target) or the respective shRNA plasmid (shATG14 (KD1: TRCN0000142849 or KD2: TRCN0000144080) or shNOX2 (KD1: TRCN0000064590 or KD2: TRCN0000064591) (Sigma Aldrich), the gag/pol plasmid psPAX2 (Addgene ...
-
bioRxiv - Physiology 2022Quote: Lentiviral pLKO.1 plasmids harboring shRNAs directed against SLC7A1 (ID: TRCN0000042967) and DHPS (ID: TRCN0000330717 and ID: TRCN0000330796) were obtained from Sigma-Aldrich. Cells were transduced with the shRNA plasmids where the 714bp sequence encoding for EGFP was inserted in place of the puromycin gene at the unique BamHI and KpnI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids encoding shRNA against SYNJ2BP and AMPK α1 and α2 (TRCN0000139049, TRCN0000024000 and TRCN0000024046, respectively) as well as a control shRNA plasmid (TR30021) were purchased in pLKO from Sigma-Aldrich. PINK1-kinase dead-MS2-PP7 ...
-
bioRxiv - Molecular Biology 2020Quote: For shRNA transduction, individual shRNAs targeting mouse Arid1a (TRCN0000238303, shArid1a-#1; TRCN0000238306, shArid1a-#5) were obtained from Sigma Mission shRNA library (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO lentiviral vectors expressing non-targeting shRNA and shRNAs targeting SOX2 and SOX15 were purchased from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2021Quote: Two pLKO.1-shRNA constructions against the HDAC6 transcript were selected from the MISSION shRNA collection (SIGMA Aldrich). The constructs references were TRCN0000314976 for sh1_HDAC6 and TRCN0000004839 for sh2_HDAC6 ...
-
bioRxiv - Pathology 2020Quote: ... the MISSION® TRC shRNA transfer vector containing the ClC-5 shRNA target sequence CACCGAGAGATTACCAATAA (Sigma-Aldrich, #TRCN0000043904) was co-transfected with the third generation vectors VSVG ...
-
bioRxiv - Cancer Biology 2020Quote: ... Non-targeting shRNA control (shCtrl) and shRNA constructs targeting Keap1 (TRCN0000156676) and CUL3 (TRCN0000012778) were purchased from Sigma and packaged into lentiviral vectors using standard protocols.
-
bioRxiv - Microbiology 2023Quote: ... pLKO.1-based Mission shRNA constructs targeting Raf1 were obtained from the Sigma-Aldrich Mission shRNA library (Sigma/Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral constructs containing the shRNA targeting the gene of interest were obtained from the MISSIONx shRNA library (Sigma), facilitated by Erasmus Center for Biomics (Key Resource Table) ...
-
bioRxiv - Microbiology 2022Quote: ... EIF4E2 shRNA#2 (sh4EHP#2) (Sigma, TRCN0000280916) and EIF4E2 shRNA#3 (sh4EHP#3 ...
-
bioRxiv - Microbiology 2022Quote: ... GIGYF2 shRNA#2 (shGIGYF2#2) (Sigma, TRCN0000138937) and GIGYF2 shRNA#3 (shGIGYF2#3 ...
-
bioRxiv - Neuroscience 2021Quote: ... or the control shRNA vector (SHCOO2; Sigma) into HEK293T cells and collected 48hours later ...
-
bioRxiv - Biochemistry 2019Quote: ... the most effective UCHL1 shRNA (TRCN0000007273; Sigma) for lentiviral infection was used for the experiments.
-
bioRxiv - Cancer Biology 2020Quote: ... or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC; TRCN0000381243; Sigma), along with psPAX2 packaging and pMD2.G envelope plasmid DNA at a ratio of 4:3:1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... CALCRL MISSION shRNA (shCALCRL#1, Sigma-Aldrich, Cat# TRCN0000356798 ...
-
bioRxiv - Cancer Biology 2020Quote: ... E2F1 MISSION shRNA (Sigma-Aldrich, Cat# TRCN0000039659). List of shRNA sequences ...
-
bioRxiv - Cell Biology 2021Quote: ... We used MISSION shRNAs (pLKO.1; Sigma): TERF2 (TRNC0000004812) ...
-
bioRxiv - Microbiology 2022Quote: ... GIGYF2 shRNA#1 (shGIGYF2#1) (Sigma, TRCN0000135151), GIGYF2 shRNA#2 (shGIGYF2#2 ...
-
bioRxiv - Microbiology 2022Quote: ... and EIF4E2 shRNA#3 (sh4EHP#3) (Sigma,). GIGYF2 shRNA#1 (shGIGYF2#1 ...
-
bioRxiv - Microbiology 2022Quote: ... EIF4E2 shRNA#1 (sh4EHP#1) (Sigma, TRCN0000152006), EIF4E2 shRNA#2 (sh4EHP#2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA constructs were obtained from Sigma Millipore (control (SHC002) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA construct number TRCN000094248 from Sigma mouse TRC shRNA library was used for knockdown studies of mouse FMOD ...
-
bioRxiv - Cancer Biology 2022Quote: ... IRF3 shRNA-1 (Sigma-Aldrich, cat. TRCN0000005921); and IRF3 shRNA-2 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of control shRNAs (Sigma) and a puromycin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: Lentiviral shRNAs for RIOK2 and IMP3 (Sigma, MISSION shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... MISSION pLKO.1 lentiviral shRNA (MilliPORE Sigma) was used to knockdown Smad1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or a control shRNA (Sigma, cat#SHC002V). Murine 266-6 cells (ATCC cat#CRL-2151 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or shRNA against St6gal1 (Sigma, cat#TRCN00000018818). Stable polyclonal populations were isolated by puromycin selection.
-
bioRxiv - Genetics 2019Quote: shRNA sequences were obtained from Sigma-Aldrich in pLK0.1 lentivirus vector ...
-
bioRxiv - Microbiology 2021Quote: ... four shRNA hairpins were obtained from Sigma mission catalogue 3-1245h1C1 ...
-
bioRxiv - Cell Biology 2020Quote: ... MISSION shRNA constructs were obtained from Sigma in pLKO.1-puro vectors ...
-
bioRxiv - Cancer Biology 2020Quote: ... All shRNAs were obtained from Sigma Aldrich.
-
bioRxiv - Cancer Biology 2019Quote: Murine shRNA constructs were obtained from Sigma via the University of Colorado Functional Genomics Shared Resource (TRC1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or a control non-targeting shRNA (Sigma) as described above ...
-
bioRxiv - Immunology 2020Quote: ... RNF20 or CtIP+RNF20-specific shRNAs (Sigma) and then placed cells under puromycin selection (0.5 μg/ml) ...
-
bioRxiv - Immunology 2020Quote: ... pLKO shRNA targeting BBS1 (Sigma-Aldrich, #TRCN0000417688), pEGFP-N1-hBBS1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-non-mammalian shRNA construct (Sigma, SHC002) was used as a control ...
-
bioRxiv - Cell Biology 2022Quote: pLKO-shRNA constructs were purchased from Sigma. The following shRNA sequences were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... shIGFR1#2 (Mission TRC shRNA, TRCN0000000422, Sigma). For lentivirus production ...
-
bioRxiv - Cancer Biology 2023Quote: ... shINSR#2 (Mission TRC shRNA, TRCN0000000379, Sigma), shGLUT1 (Mission TRC shRNA ...
-
bioRxiv - Cell Biology 2023Quote: All shRNAs were obtained from Sigma-Aldrich, except for the scramble shRNA which was obtained from Addgene (a gift from David Sabatini ...
-
bioRxiv - Neuroscience 2023Quote: ... or a non-targeting control shRNA (Sigma, SHC001 ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1 lentiviral shRNA (MilliPORE Sigma) was used to knockdown LOX or CXCL14 in 2H11 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following shRNAs were obtained from Sigma: HDAC2 (TRCN0000375947 ...
-
bioRxiv - Cell Biology 2024Quote: ... Non-targeted shRNA (Millipore Sigma Cat#SHC016) or 5-6 gene specific shRNA using 5-6 lentivirus transfer plasmids per gene target (see Key Resources Table ...
-
bioRxiv - Cancer Biology 2024Quote: All shRNAs were obtained from Sigma-Aldrich. The TCRN are as follows ...