Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for Mouse VPS10 domain containing receptor SorCS1 SORCS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the long-lasting dopamine receptor ligand [3H] 2-amino-6,7-dihydroxy 1,2,3,4-tetrahydronapthalene (ADTN) (Sigma) was injected to a final estimated concentration of 200 nM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 50 ng mL−1 receptor activator of nuclear factor kappa-B ligand (Sigma Aldrich). The scaffold was then perfused at 56 μL per second for 28 days in the same medium ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-α1 GABAA receptor subunit (1:300; 06-868, Sigma-Aldrich, St. Louis, USA), guinea pig anti-α2 GABAA receptor subunit (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Glucocorticoid Receptor antibody (#3660, Cell Signalling Technology) or control IgG antibody (#03-198, Merck Millipore) and incubated for 1 h at room temperature whilst rotating ...
-
bioRxiv - Neuroscience 2023Quote: ... or the selective GABA-A receptor agonist muscimol (100 ng; Sigma Aldrich, St. Louis, MO). Each rat received one vehicle injection and one drug injection in a counterbalanced order over two consecutive days ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT2C receptor antagonist RS-102221 was bought from Sigma-Aldrich (St Louis, USA) and dissolved in DMSO ...
-
bioRxiv - Immunology 2023Quote: ... with 1 mg/kg of the sphingosine-1-phosphate receptor 1 (S1PR1) antagonist FTY720 (Sigma) 2 hours before and 22 hours after a combination of PR8 and 5-OP-RU was administered 40,41 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ki16425 (potent antagonist of the lysophosphatidic acid receptors LPA1 and LPA3, SML0971-5MG, Sigma-Aldrich), PF-8380 (Autotaxin inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT2C receptor agonist MK-212 was bought from Sigma-Aldrich (St Louis, USA) and dissolved in Cortland’s salt solution (NaCl 124.1 mM ...
-
bioRxiv - Microbiology 2020Quote: ... Bound domain C was then detected using an HRP-conjugated anti-FLAG antibody (Sigma-Aldrich, St. Louis, MO) and Ultra-TMB substrate (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HA9 (inhibitor of the substrate binding domain of Hsp70) and brefeldin A (disrupts Golgi apparatus, Sigma-Aldrich, Merck) were added for 30 min ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated with the primary antibody (anti-Htt raised against the Proline-rich domain (PRD) (MAB5492, Millipore) at a dilution of 1/500 in PBST for 2 h at RT ...
-
bioRxiv - Biochemistry 2024Quote: ... the domain deletion constructs (APLF, APLFΔAD, APLFΔFHA) transfected ES E14 cells were treated with 10μM etoposide (Sigma #E1383) for 4hours ...
-
bioRxiv - Biochemistry 2024Quote: ... PAR was synthesized enzymatically by PARP5 catalytic domain (0.1 mg/mL) with histones (2 mg/mL, Sigma #H9250) and NAD+ (20 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were incubated with TBST-Blotto containing primary monoclonal mouse anti-FLAG M2 antibody (1:2,000 dilution, Sigma) or monoclonal mouse anti-GAPDH antibody (1:2,000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated in a primary antibody solution containing 1:250 mouse anti-NeuN (Millipore; MA, USA), 1:200 goat anti-DCX(Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... tendons were transferred into a primary antibody solution containing 1:100 mouse anti-Tpm3.1 antibody (2G10.2; Millipore Sigma) in permeabilization/blocking solution ...
-
bioRxiv - Immunology 2020Quote: ... then permeabilized and stained intracellularly for granzyme B in 2.4G2 supernatant containing 10% normal mouse serum and 0.5% saponin (Sigma). Sample data was acquired on either an LSR II or LSR Fortessa flow cytometer (both from BD Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... The primary antibody solution containing 1:400 mouse α-FLAG (clone M2, Sigma-Aldrich, St. Louis, Missouri, USA) and/or 1:1,500 rabbit α-FCaBP 64 in 1% BSA in PBS was added for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... each mouse was given one bottle of water and one bottle containing 1% OVA (grade II, Sigma A5253), unless otherwise stated ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated in a primary antibody cocktail containing mouse anti-NeuN (Millipore, MAB277 lot 3574318, 1:500 dilution), chicken anti-tyrosine hydroxylase (TH ...
-
bioRxiv - Neuroscience 2020Quote: ... and retinal levels of human Pi and serum levels of human insulin were measured using human Pi and human insulin ELISA kits (EZHPI-15K and EZHI-14K, respectively; Millipore, Darmstadt, Germany) according to the manufacturer’s instructions and as described previously (Isiegas et al. ...
-
bioRxiv - Immunology 2023Quote: ... Phosphorylated ERK was measured by preparing epithelial cells as described above (Colon epithelial cell isolation) and using a Phospho-Erk1 (pThr202 / pTyr204 + Erk2 (pTyr185/187) and pan-Erk1 / 2 ELISA Kit from Sigma (Cat. RAB0349) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... Plasma concentrations of acylated ghrelin and leptin were determined by commercial ELISA kits according to the manufacturers’ instructions (Spi Bio #A05117.96 and Millipore #EZML-82K, respectively).
-
bioRxiv - Microbiology 2021Quote: ... and Mouse IgE Single Plex Magnetic Bead Milliplex MAP kit (Millipore). Samples were diluted 1:12500 (IgA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TNF-α using Milliplex Mouse Th17 Luminex kit (EMD Millipore) on a MagPix Luminex instrument ...
-
bioRxiv - Cell Biology 2022Quote: ... the Duolink® In Situ Red Starter Kit Mouse/Rabbit (Sigma) was used according to manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2023Quote: Duolink In Situ Red Starter Kit Mouse/Rabbit (Sigma Aldrich, USA) was used and performed following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Utilizing the Duolink in situ orange PLA mouse/rabbit kit (Sigma), these two antibodies were spatially coincided with high precision (< 40 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluted solution of receptors was concentrated to 500 μL using 50 kDa spin filters (Millipore) and further purified by size exclusion chromatography on a Superdex 200 Increase 10/300 column (GE Healthcare ...
-
bioRxiv - Developmental Biology 2021Quote: ... 100 ng/L ethinylestradiol (EE2) or 10μM ICI 182,780 (ICI, an estrogen receptor antagonist, Sigma-Aldrich)(aqueous exposure in system water ...
-
bioRxiv - Neuroscience 2020Quote: ... and the AMPA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 μM, Sigma Aldrich), for 2 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Immune mice sera samples were heat-inactivated and treated with receptor destroying enzyme (RDE, SIGMA-ALDRICH) before use ...
-
bioRxiv - Microbiology 2020Quote: ... four volumes of receptor destroying enzyme (RDE, Vibrio cholera filtrate, Sigma Aldrich, San Diego, CA, USA) were added to each volume of mouse serum ...
-
bioRxiv - Neuroscience 2021Quote: ... All experiments were performed in the presence of blockers of GABA receptors (picrotoxin, 30 μM, Sigma) and glutamate receptors (NBQX ...
-
bioRxiv - Neuroscience 2022Quote: ... both receptors were nucleofected together with VAMP2-SEP and DAMGO 10μM or DPDPE 10μM (Sigma-Aldrich) added to the culture medium for 18h in the incubator before imaging ...
-
bioRxiv - Neuroscience 2022Quote: ... while IPSCs were completely inhibited by the GABAA receptor antagonist bicuculline (Sigma-Aldrich, St. Louis, MO). To assess synaptic input from either or both POm and vM1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following drugs were used for pharmacological manipulations: adrenergic α1 receptor agonist – phenylephrine (10 μM Sigma P6126); AMPA & Kainate receptors antagonist – CNQX (10 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... and probe the receptor using anti-FLAG peroxidase coupled antibody (1:2000, Sigma, Cat. no. A8592). Data were quantified using ImageLab software (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Neuroscience 2024Quote: ... and before and 20–60 minutes after addition of GABA receptor antagonist bicuculline (10μM; Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... The rAQP4ct protein domain was concentrated and exchanged into buffers for biophysical analyses with an Amicon centrifugal filter (Millipore).
-
bioRxiv - Biochemistry 2021Quote: ... The C-terminal domain (CTD) of DRH-3 (residues 940-1108) was cloned into the expression vector pET15b (Novagen), and the resulting clone carries an N-terminal His6 tag and a thrombin cleavage site ...
-
bioRxiv - Biophysics 2020Quote: All used BMPs and extracellular domains (ECD) of the BMPR-FC chimeras were bought from Sigma Aldrich (Missouri, USA) and R&D systems (Minnesota ...
-
bioRxiv - Biochemistry 2019Quote: ... A synthetic gene encoding the KRAB domain (residues 1-71) from ZNF93 (UniProt: P35789) codon-optimized for E.coli was expressed from the pET20 plasmid (Novagen) with N-terminal Twin-StrepII and maltose binding protein (MBP ...
-
bioRxiv - Cell Biology 2021Quote: ... For assessment of hydrodynamic radius, purified motor domains (wild-type, jordan, shaker-2) were concentrated by centrifugation (10’000 MWCO; Amicon, EMD-Millipore) and directly analyzed using size exclusion chromatography (see below) ...
-
bioRxiv - Genetics 2020Quote: ... The obtained mix of double-stranded DNA oligonucleotides was methylated by murine DNMT3A or DNMT3B catalytic domain for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Genetics 2020Quote: ... were co-expressed with the C-terminal domain of human DNMT3L (residues 178–386 of NCBI accession NM_175867) on a modified pRSFDuet-1 vector (Novagen), in which the DNMT3B or DNMT3A sequence was preceded by a hexahistidine (His6 ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA targeting the LIM domain of EPLIN (# SASI_Hs02_00326071; TATTGTAAGCCTCACTTCAA) and a scrambled control siRNA (#SIC001) were obtained from Sigma-Aldrich.
-
bioRxiv - Immunology 2021Quote: ... Nunc-Immuno™ MicroWell™ 96 well ELISA plates (Millipore) were coated overnight with 50 μl per well of 2ug/ml RBD-His or Spike-His protein in carbonate buffer pH9 ...