Labshake search
Citations for Millipore Sigma :
401 - 450 of 8155 citations for BD 3 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-substance P (1:400; Millipore Cat# MAB356, RRID:AB_94639), or rabbit anti-DsRed (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-ZO-1 clone R40.76 (rat, EMD Millipore Sigma #MABT11), 1:100 ...
-
bioRxiv - Genetics 2023Quote: ... Rat anti-RNA Pol II (#04-1571 Millipore, 1:1000), rabbit anti-pH3 (#SC-8656-R Santa Cruz Biotechnology 1:100) ...
-
bioRxiv - Genetics 2023Quote: ... cells were incubated with FITC anti-rat IgG (Sigma-Aldrich) and AF633 anti-rabbit IgG (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Horseradish peroxidase-conjugated goat anti-rat secondary antibody (Sigma-Aldrich) diluted 1:2000 was detected with SuperSignal® West Pico Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Cell Biology 2023Quote: ... on 200 μg/mL rat collagen type 1-coated (Sigma) plates ...
-
bioRxiv - Neuroscience 2023Quote: ... and rat anti-HA (Millipore Sigma, Cat# 11867423001, 1:1000). Fluorescent second antibodies were ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-human E-cadherin (EMD Millipore, DECMA-1) at a concentration of 1/200 in a humidified incubator overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... or anti-rat IgG alkaline phosphatase conjugate (Sigma-Aldrich A8438) secondary antibodies (1:200 dilution in TTBS-milk ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-somatostatin (Merck Millipore, clone YC7, rat, dilution 1:150), anti-vasoactive intestinal peptide (Thermofisher ...
-
bioRxiv - Physiology 2023Quote: ... rat anti-PECAM1 (Sigma Aldrich, CBL-1337-1, 1:1000), rabbit anti-NPHS2 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... rat monoclonal antibody against Dopamine Transporter (Millipore Cat# MAB369, RRID:AB_2190413). Goat anti-Mouse IgG Alexa Fluor 488 (Thermo Fisher Scientific Cat# A-11001 ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3) Progesterone (Sigma P8783) – 0.02 µg/ml final concentration ...
-
bioRxiv - Developmental Biology 2021Quote: Nutlin-3 (Sigma, N6287) was dissolved in corn oil (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... 3% donkey serum (Millipore), and 0.2% Triton X-100 in PBS ...
-
bioRxiv - Genetics 2019Quote: ... 3 mM ATP (Sigma), 1 mM CaCl2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pHistone 3 S10 (Millipore), pp53 S15 (Cell Signaling) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3% BSA (Sigma) in PBS for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 μM SB202190 (Sigma), 1 μM nicotinamide (Sigma) ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 µL fibronectin (Sigma) and 50 µL cell type-specific medium (RPMI1640 – mouse ...
-
bioRxiv - Immunology 2021Quote: ... and 3% sucrose (Sigma) for 13 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... 3′-Diaminobenzidine (Sigma-Aldrich) as a substrate ...
-
bioRxiv - Microbiology 2020Quote: ... 3-HPPA (91779, Sigma) (n=4 biological replicates ...
-
bioRxiv - Systems Biology 2020Quote: ... 3% Dextran (Millipore Sigma)) containing various amount of NaCl so that the final concentration of NaCl would correspond to those in Fig ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Biophysics 2020Quote: ... 3 uL benzonase (Novagen)) and sonicated ...