Labshake search
Citations for Millipore Sigma :
551 - 600 of 8155 citations for BD 3 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Rat-tail collagen was obtained from Sigma Aldrich (St Louis, MO). All other cell culture components such as fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and collagen type I solution from rat tail (Sigma-Aldrich, C3867) were purchased reagents.
-
bioRxiv - Pathology 2021Quote: ... rats were injected intraperitoneally with 1 U/kg human insulin (Sigma). Blood glucose from the tail vein was measured using a glucometer at the desired time (0 ...
-
bioRxiv - Immunology 2020Quote: ... Mice were treated with 200 μg M279 or rat IgG (Sigma) intraperitoneally 3 times a week for 9 weeks ...
-
bioRxiv - Neuroscience 2020Quote: ... then incubated with rat anti-GR (1:1000, Millipore-Sigma MABN778) and either rabbit anti-H4R3me2a (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... b1-integrin (1:1000 dilution, Rat monoclonal, clone MB1.2; Millipore, #MAB1997), HSC70 (1:5000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... goat anti-rat IgG-POD polyclonal antibody (1:4000, Sigma-aldrich), goat anti-rabbit IgG-POD polyclonal antibody (1:20000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 100 mg of rat albumin (Sigma-Aldrich, St. Louis, MO) diluted in 10 mL artificial cerebrospinal fluid (aCSF ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was incubated in 1:1000 rat anti-HA (Sigma) or 1:200 mouse anti-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... rat monoclonal anti-HA-Peroxidase high affinity (Roche, Sigma-Aldrich, 12013819001), rabbit polyclonal anti-Actin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-tyrosine α-tubulin (1:500, EMD Millipore, MAB1864). Secondary antibodies (all used at 1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Control mice received 250µg of IgG from rat serum (Sigma, 18015) i.p ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pre-coated with rat-tail collagen (30 µg ml-1, Sigma) at a density of 3.0×104 cells/well in glucose-supplemented DMEM medium (containing 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were stained with 1:500 rat anti-HA (Sigma) followed by 1:1000 goat anti-rat Alexa 594 (Thermo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were stained with 1:500 rat anti-HA (Sigma), followed by 1:1000 goat anti-rat Alexa 594 (Thermo) ...
-
bioRxiv - Neuroscience 2023Quote: ... . Rats were anaesthetized with either ketamine (100 mg/kg, i.p., Sigma) and xylazine (10 mg/kg ...
-
bioRxiv - Neuroscience 2023Quote: ... a rat monoclonal anti-poly(GR) antibody (clone 5A2, MABN778, Millipore), a Living Colors® EGFP mouse monoclonal antibody (632569 ...
-
bioRxiv - Biochemistry 2023Quote: ... HA clone 3F10 (rat monoclonal, conjugated to FITC, Sigma-Aldrich / Merck), GFP (mouse monoclonal ...
-
bioRxiv - Microbiology 2023Quote: ... Each membrane was incubated with rat anti-HA primary antibody (Sigma 11867423001 ...
-
bioRxiv - Neuroscience 2023Quote: The following antibodies were used: anti-hemagglutinin (HA, rat, Sigma-Aldrich). For immunoblotting ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were blocked with 50 ug/mL rat IgG (Sigma-Aldrich) for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat anti-PCDH10 antibody (Anti-OL-protocadherin antibody, clone 5G10, Sigma) or mouse anti-GAPDH (Merck ...
-
bioRxiv - Bioengineering 2023Quote: INS-1 832/13 rat insulinoma β-cells (Millipore, Cat# SCC207) were cultured in RPMI media supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats were slowly infused with urethane (0.84 g/kg; 102452447, Sigma) (diluted in saline at 150 mg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received daily subcutaneous injections of 10 μg estrone (Sigma-Aldrich) in 0.1 ml sesame oil ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Cell Biology 2020Quote: ... Cyanine 3 (NC, Sigma-Aldrich) was used as a control of transfection efficiency.
-
bioRxiv - Developmental Biology 2021Quote: ... 3-bromopyruvate (Sigma Aldrich #16490) or 2-deoxy-D-glucose (CARLROTH #CN96.3 ...
-
bioRxiv - Developmental Biology 2021Quote: The drug 3’-dA (Sigma) was dissolved in M16 medium (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked with 3% BSA (Sigma) in PBS for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 3×FLAG peptide (F4799, Sigma), Expi29™ expression medium (A1435101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 min (3–18, Sigma) after homogenization by a 5 ml glass-glass douncer (Braun ...
-
bioRxiv - Molecular Biology 2021Quote: ... also containing 3% BSA (Sigma) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Benzonase (Millipore, 70746-3). The lysates were homogenized by sonication and centrifuged for 1 h ...
-
bioRxiv - Genetics 2019Quote: ... and 3 nM TTNPB (Sigma). Day 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 mM MgCl2 (Sigma-Aldrich), 0.7 % Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...