Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and 2’,3’-cGAMP (CAS no. 1441190-66-4) were obtained from Sigma-Aldrich and used without further purification.
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4-week-old mice were administered three subcutaneous injections of tamoxifen (Sigma Aldrich) in corn oil over 5 days (days 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and subsequently fixed overnight at 4°C in 4% paraformaldehyde (Sigma). Next ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Samples were fixed overnight at 4°C in 4% paraformaldehyde (Sigma) in PBST ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Samples were fixed overnight at 4°C in 4% paraformaldehyde (Sigma) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10−6 M 4-hydroxytamoxifen (4OHT) (Sigma), 10−6 M Fulv (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... 4′,6-Diamidino-2-phenylindole (DAPI, Sigma) was used to stain cell nuclei ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DAPI (4’.6-Diamidin-2-phenylindol, Sigma) was used to visualize nuclei ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole (Millipore) was used at 1:5,000 dilution.
-
bioRxiv - Genetics 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Sigma) staining was performed in PBS for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, Sigma) was used at a 1:1000-1:2000 dilution for DNA staining.
-
bioRxiv - Neuroscience 2023Quote: ... Fluoxetine (F132) and 4-Chloro-DL-phenylalanine (PCPA; C6506) were purchased from Sigma Aldrich (Deisenhofen, Germany). Drugs were dissolved in 0.9% NaCl to the respective concentration ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Cell Biology 2020Quote: ... then rinsed 3 times in PBS (5 minutes each) and embedded in 4% low gelling temperature agarose in PBS (Sigma-Aldrich A0701). 55 μm slices of the ovaries were cut with a vibratome (Leica VT 1000 S ...
-
bioRxiv - Biochemistry 2022Quote: ... pLANT-2/RIL–RFC[1+5] was co-transformed with pET(11a)-RFC[2+3+4] into BLR(DE3) cells (Novagen, Madison, Wisconsin). The cell lysate was clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The number of viable cells was determined by mitochondrial conversion of 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma Aldrich, Missouri, USA) to formazan ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were passaged at a 1:3 to 1:6 ratio every 7 days using cell dissociation solution-non enzymatic (Sigma) and plated in fresh BME matrix droplets.
-
bioRxiv - Neuroscience 2023Quote: ... Brains of P0 pups were kept in 4% PFA in 4°C overnight and then transferred to 4°C 30% sucrose (Sigma-Aldrich, S5016) with 0.01% sodium azide (Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: Samples were incubated with primary antibody overnight at 4°C in PBT (PBS with 3% Triton X-100 (Sigma-Aldrich X100-100 mL)) with 5% NGS (Capralogics GS0250) ...
-
bioRxiv - Immunology 2024Quote: ... IgGs were incubated for 4–5 h at 37°C in digestion buffer (4% (w/w of IgG) activated Papain from papaya latex (Sigma Aldrich), 10 x L-Cysteine ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 5’-Chloro-2’-deoxyuridine (CIdU) (C6891 from Sigma), 100µM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5-Chloro-2’-deoxyuridine (CldU) (Millipore Sigma; #C6891), Hydroxyurea (Tokyo Chemical Industry ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions were digested at 37 °C for 4-6 hours with 500 ng of trypsin (Sigma), chymotrypsin (Thermo) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Bioengineering 2020Quote: ... and MEF cells fixed with 4°C 4% formaldehyde (Sigma-Aldrich, 252549) in PBS for 20 minutes at room temperature ...