Labshake search
Citations for Millipore Sigma :
4351 - 4400 of 4463 citations for Recombinant Human IL12B Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Quantification of IL-6 in media was assessed via Human IL-6 ELISA kit according to manufacturer instructions (Sigma Aldrich; St. Louis, MO).
-
bioRxiv - Neuroscience 2021Quote: ... per well of a 6 well plate of differentiated human neural cultures (~2 months old) along with 3μg/ml of polybrene (Sigma-Aldrich #TR-1003-G), pipetting the LV concentrate directly onto the culture (drop-wise) ...
-
bioRxiv - Biophysics 2021Quote: ... myoglobin from equine heart (Myo, CAS number 100684-32-0), human apo-transferrin (apo-TFF, CAS number 11096-37-0) were purchased from Sigma-Aldrich (Merck, Germany) and stored according to manufacturer recommendation ...
-
bioRxiv - Biochemistry 2021Quote: ... These Wild Type or Mutant Type let-7a-5p plasmids were co□transfected into treated human chondrocytes cells along with NC mimics or KCNQ1OT1 mimic (Sigma□Aldrich; Merck KGaA) using Lipofectamine 6000 following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The MILLIPLEX MAP Non-Human Primate Cytokine Magnetic Bead Panel - Premixed 23 Plex – Immunology Multiplex Assay (Millipore, Burlington, MA, USA; #PCYTMG-40K-PX23) was performed on collected plasma samples following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... human bronchoalveloar lavage fluid and mouse serum of animals dosed with human THP were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0751) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: New Zealand rabbits were immunized subcutaneously with 0.4 mg human TNFa (Shanghai Primegene Bi-Tech) in complete adjuvant (Sigma Chemical, St. Louis, MO). After the initial immunization ...
-
bioRxiv - Cell Biology 2019Quote: ... animals were boosted 5 times in a 3 week-interval with 0.2 mg human TNFa in incomplete adjuvant (Sigma Chemical, St. Louis, MO). Final boost was given intravenously with 0.4 mg the protein in PBS four days before splenectomy ...
-
bioRxiv - Immunology 2021Quote: 6 × 106 cells/channel of human umbilical vein endothelial cells (HUVECs, ATCC-PCS-100-013) were seeded into the fibronectin (50 μg/mL, Sigma-Aldrich cat. # F0895) coated channels of a 48-well microfluidic plate (Bioflux ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse was induced by injecting 2 month-old female BALB/c mice with2 mg human-derived proteoglycan (PG) together with 2 mg DDA (Sigma, MO, united States). as described previously (1) ...
-
A Universal Proximity CRISPR Cas12a Assay for Ultrasensitive Detection of Nucleic Acids and ProteinsbioRxiv - Synthetic Biology 2019Quote: ... Human serum, magnesium chloride hexahydrate (MgCl2⋅6H2O), and 100×Tris−EDTA (TE, pH 7.4) buffer were purchased from Sigma-Aldrich (Mississauga, ON, Canada). NANOpure H2O (> 18.0 MΩ) ...
-
bioRxiv - Systems Biology 2019Quote: ... The assay named ‘Other Luminex’ was performed only for study SLVP015 in 2007 using the Human 42-Plex Polystyrene Kit (EMD Millipore, H42; MPXHCYTO060KPMX42) and data was processed in the same way as for the Luminex assays described above (measurement units reported were Zlog2)28.
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates from different groups were collected and incubated with magnetic bead RIP buffer containing anti-human argonaute 2 (Ago2) antibody (Millipore, Billerica, MA, USA) and anti-human CPEB2 antibody (Proteintech ...
-
bioRxiv - Microbiology 2020Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP non-human primate cytokine panel and Luminex 200 (Millipore Corp., Billerica, MA) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human lung fibroblast cells MRC-5 (ATCC® CCL-171) were propagated in Dulbecco’s Modified Eagle Medium (DMEM; Sigma, St. Louis, MO, USA) supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... and rested overnight at 37°C/5%CO2 in RPMI-1640 medium supplemented with 10% heat-inactivated human AB serum (Sigma Aldrich, Missouri, USA), 2 mM L-glutamine and 1 mM sodium pyruvate before infection ...
-
bioRxiv - Immunology 2020Quote: ... monoclonal antibodies were produced by transient co-transfection of 293-F cells with human heavy chain and light chain antibody expression plasmids using polyethylenimine (PEI) (Sigma-Aldrich, catalog #408727). Seven days after transfection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Neuroscience 2020Quote: ... untagged human α-synuclein (100 μg/well) —purified as previously described [17]—and 10 μM ThT in dPBS (Sigma-Aldrich, St. Louis, MO) were combined in a final volume of 95 μl of dPBS ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
bioRxiv - Immunology 2020Quote: Cytokine were measured in cell-free PBMC supernatant using MILLIPLEX-MAP human cytokine/chemokine magnetic bead panel (EMD Millipore Corporation, Billerica, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The pyrosequencing assay was validated using SssI-treated human genomic DNA as a 100% methylation control and human genomic DNA amplified by GenomePlex Complete Whole Genome Amplification kit (Sigma-Aldrich, WGA2-50RXN) as 0% methylation control ...
-
bioRxiv - Immunology 2022Quote: Cells were isolated from human blood using density gradient centrifugation agent Ficoll®-Paque Premium (17-5442-02, GE Healthcare, SIGMA, Darmstadt, Germany). Monocytes were plated at 3×105 cells per well in plastic 24 well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse mAb MEM48 which recognizes the human β2 integrin subunit (catalog #CBL158) and the mouse mAb 1965 against the human β1 integrin subunit (catalog #MAB1965) were from EMD Millipore (Burlington, MA). The rat PE-conjugated mAb against F4/80 (catalog #12-4801-82 ...
-
bioRxiv - Biochemistry 2024Quote: ... Electroporated cells were cultured in erythroid differentiation medium (EDM) consisting of IMDM (GibcoTM, 12440061) supplemented with 330 µg/ml of Holo-Human Transferrin (Sigma-Aldrich, T0665-1G), 10 µg/ml of recombinant human insulin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... was added to the cell pellet and stored at −20°C prior to being assayed for insulin using human insulin specific RIA (Millipore Cat# HI-14K).
-
bioRxiv - Immunology 2024Quote: ... Two different Mission lentivirus-based plasmids of shRNAs (clone numbers TRCN0000123050 and TRCN0000436778) against human ZBP1 and the shcontrol vector TRC2 pLKO.5-puro nonmammalian shRNA (SHC202) were obtained from Sigma-Aldrich (Burlington, MA). 293T cells were cotransfected with the shRNA and packaging plasmids psPAX2 and pMD2 using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)36,37 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)32,33 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... human islets were dispersed using dissociation solution (1X TrypLE™ Express solution - Thermo Fisher Scientific, with 40 µg/mL DNase I - Sigma-Aldrich) through gentle pipetting for 10 minutes at 37°C ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... The lentivirus enriched-medium was immediately used to transduce the human fibroblasts growing on a T25 flask in the presence of 8µg/ml polybrene (Sigma-Aldrich, San Luis, MO). Infected fibroblasts were maintained in culture until having enough cells for cell sorting ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: Concentrations of cytokines in supernatants of T cell cultures were assessed with the MILLIPLEX MAP Human Th17 magnetic bead panel kit (Merck Millipore, Burlington, MA, USA) and the Luminex® 200™ system according to the guidelines of the manufacturer ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a subsequent 6-day differentiation step in serum-free medium containing 50 ng/ml human brain derived neurotrophic factor (BDNF) (Sigma-Aldrich, Cat# B3795). Cells were seeded at an initial density of 2 × 104 cells/cm2 in 24-well plate coated with Type I collagen (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse (5 x 105 cells) and human (2 x 105 cells) keratinocytes were seeded onto 12 mm diameter inserts (Millipore, Catalog No. PIHP01250) and cultured in CnT-Prime medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cell lysate was generated as a Western blot positive control from the human endometrial epithelium Ishikawa cell line (Sigma-Aldrich, Madrid, Spain), as in a previous study (Vilella et al. ...
-
bioRxiv - Bioengineering 2024Quote: IDUA enzyme expression was measured fluorometrically in a 96-well plate using a Human IDUA ELISA kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s sandwich assay protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CAR T cell product was cultivated in RPMI+10%FBS+1%PS at 37°C with 5% CO2 for experiments and cryopreserved as 10×106 cells/mL in 1 mL 90% heat-inactivated Human AB Serum (Sigma-Aldrich, Cat.#H4522) +10% DMSO in liquid nitrogen ...
-
bioRxiv - Immunology 2024Quote: ... Total transferrin was kept constant at 1.2 mg/mL by adjusting human apotransferrin (unbound transferrin) concentrations (R&D systems, 3188-AT-001G/Sigma Aldrich, T1147) accordingly ...
-
bioRxiv - Neuroscience 2024Quote: ... Both mouse and human brain sections were labeled for TH (mouse monoclonal, clone LNC1, 1:2000, Catalog No. MAB318, EMD Millipore, Burlington, MA) and VGLUT2 (rabbit polyclonal ...
-
bioRxiv - Bioengineering 2024Quote: ... human chorionic gonadotropin (hCG, for Jurkat: high 1000 IU/mL and low 200 IU/mL; PBMC: 500 IU/mL, Sigma catalog #CG5-1VL). Media controls were used to determine if media components alone affect protein secretion and expression ...
-
bioRxiv - Immunology 2021Quote: ... and Tumor necrosis factor-alpha (TNF-α)) were measured with a Milliplex MAP High-Sensitivity Human Cytokine Panel (HSCYTMAG-60SK-13, Millipore Corp., Billerica, MA) on a Luminex MagPix (Millipore Corp. ...
-
bioRxiv - Microbiology 2022Quote: ... and HEK293-ACE2 cells [HEK293 cells (ATCC CRL-1573) stably expressing human ACE2]22 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% FBS ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were washed three times with saline at 200 × g for 10 min at RT to remove residual Percoll and suspended in RPMI 1640 medium (Cellgro, Manassas, VA) supplemented with 5% human serum (Sigma-Aldrich, St. Louis, MO), unless otherwise stated ...
-
bioRxiv - Genomics 2019Quote: ... we measured 41 different cytokines and chemokines using the Milliplex MAP Human Cytokine/Chemokine Magnetic Bead Panel (Millipore kit no. HCVD3-67CKHCYTOMAG-60K, Millipore Corp, St. Charles, MO). According to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and lymph node from BALB/cJ mice and humans were harvested and either fixed for 48 h at RT in 10% neutral buffered formalin (Sigma-Aldrich, St. Louis, MO) or zinc-fixation buffer (pH 6.5 - 7) ...