Labshake search
Citations for Millipore Sigma :
4351 - 4400 of 5563 citations for Rat Malonyl Coenzyme A Decarboxylase MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... an intracellular flow cytometry protocol was modified from the FlowCellect™ Autophagy LC3 Antibody-based Assay Kit (Millipore, FCCH100171). After RBC lysis ...
-
bioRxiv - Neuroscience 2020Quote: PP2A activity was measured by using immunoprecipitation phosphatase assay kit according to the manufacturer’s instructions (Catalog # 17-313, Millipore). Statistical differences were analyzed using post hoc test with Bonferroni’s correction following one-way ANOVA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... using ortho-nitrophényl-β-galactoside as substrate (β-Galactosidase Reporter Gene Activity Detection Kit, Sigma St Louis MI USA).
-
bioRxiv - Neuroscience 2019Quote: ... Total protein staining solution (REVERT Total Protein Stain kit, LI-COR Inc., # 926-11010; Pyronin Y (Sigma-Aldrich # P9172)
-
bioRxiv - Cell Biology 2021Quote: Senescence-associated β-galactosidase (SA-β-gal) activity was determined with the Senescence Cells Histochemical Staining Kit (Sigma-Aldrich). Six representative images were captured on a TS100 inverted light microscope (Nikon ...
-
bioRxiv - Bioengineering 2021Quote: A phosphate assay was performed according to the manufacturer’s instruction (Malachite Green Phosphate Assay Kit, Sigma-Aldrich, The Netherlands). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... analyzed with the Duolink In Situ Red Mouse/Rabbit kit assay according to the manufacturer’s instructions (DUO94001, Sigma-Aldrich). In brief ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from apple leaves with the Spectrum Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO). Two micrograms of total RNA were treated with DNAse (Ambion ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from leaves using the GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA). The integrity of the DNA was verified by electrophoresis on a 1% agarose gel stained with ethidium bromide ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated in an endotoxin-free manner (GenElute™ HP Endotoxin-Free Plasmid Maxiprep Kit; Sigma-Aldrich) and concentrated using paramagnetic beads (HighPrep PCR Clean Up System ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNAs were isolated from young buds or leaves using the Spectrum™ Plant Total RNA Kit (SIGMA-ALDRICH). Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The pellets were then resuspended in 300µl of cold L-Amino Acid Assay buffer according to the manufacturer instructions (L-Amino Acid Quantification kit, Sigma) and lysates were then centrifuged at 13,000 rpm for 10min at 4°C to remove insoluble material ...
-
bioRxiv - Microbiology 2021Quote: ... Metabolite peaks were confirmed using the mass spectrometry metabolite library kit MSMLS-1EA (Sigma Aldrich supplied by IROA Technologies).
-
bioRxiv - Immunology 2020Quote: ... PCRs for genotyping of bacterial colonies after transformation were performed using the KAPA2G Fast ReadyMix kit (Sigma Aldrich, #KK5102) with custom designed primers and the following cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: Bacterial DNA was isolated and purified with the GenEluteTM Bacterial Genomic DNA kit (Sigma-Aldrich, St. Louis, Missouri, USA). PCR was used for the identification of six virulence factor genes (fliL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed according to manufacturer’s instructions using ApopTag Fluorescein In Situ Apoptosis Detection Kit (Millipore).
-
bioRxiv - Plant Biology 2021Quote: RNA from frozen ground stem samples was extracted using a Plant Total RNA extraction kit (Sigma, St Louis, MO) with modifications to the kit protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid was purified using a Qiagen Maxi kit and resuspended in CytoMix (25 mM HEPES, pH 7.6, 2 mM EGTA (Sigma), 5 mM MgCl2 (Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... The glycogen content was measured with a fluorometric method as described in the MAK016 assay kit instructions (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2021Quote: RNA immunoprecipitation assay was carried out according to the Magna RIP RNA-Binding Protein Immunoprecipitation Kit manufacturer’s instruction (Millipore). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PRC using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptotic cells were identified by TUNEL assay on sections using an ApopTag in situ apoptosis detection kit (Merck-Millipore).
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were stained for SA-β-galactosidase activity overnight using a Cellular Senescence Assay kit (Merck Millipore, Massachusetts, USA) and imaged the next day in the motorised widefield microscope Cell Observer (Zeiss ...
-
bioRxiv - Cancer Biology 2020Quote: Protein co-localization was assessed via proximity ligation assay (PLA) using the Duolink In Situ Red Starter Kit (Sigma) and PLA-approved primary antibodies for SC-35 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell counting and viability were performed Muse® Count & Viability Assay Kit in a Muse Cell Analyser (Merck Millipore).
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were fixed by 4% PFA and stained with warm TRAP staining solution (TRAP kit, Sigma-Aldrich, SLBW4002) for 10-30 min at 37°C27 ...
-
bioRxiv - Cell Biology 2021Quote: ... The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA immunoprecipitation (RIP) assays were performed using Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (EMD Millipore 17-700). HEK293T cells were plated on 15-cm dishes coated with poly-L-ornithine at a density of 4E4 cells/cm2 ...
-
bioRxiv - Cell Biology 2022Quote: ... ligation and amplification steps were all carried out according to manufacturer’s protocol (DuoLink PLA assay kit, #DUO92008, Sigma Aldrich). Primary antibodies used were rabbit anti-BAF (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... The membrane was hybridized with a digoxigenin-labeled DNA probe generated with a PCR DIG Probe Synthesis Kit (Sigma). Hybridization with a 5’ probe produced an 8.1 Kb band from the WT and a 5.1 Kb band from the targeted locus ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... DNA was purified from cells harvested at the indicated time points using a Mammalian Genomic DNA Miniprep Kit (Sigma). DNA was immobilized on nitrocellulose and analyzed by immunodot blotting with antibodies against cyclobutane pyrimidine dimers (CPDs ...
-
bioRxiv - Microbiology 2022Quote: The PCR products were inserted into the pET-30 Ek/LIC vector according to manufacturer’s instructions (LIC Kit, Novagen) (Table S2) ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was extracted from PBMCs using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA).
-
bioRxiv - Developmental Biology 2022Quote: The concentration of triglycerides in Drosophila larvae was measured using the Triglyceride Quantification Colorimetric Kit from Sigma (Cat. # MAK266). Ten ...
-
bioRxiv - Cancer Biology 2022Quote: The viability of THP-1 cells was assessed for 24h using the Cell Proliferation Kit II (XTT) (Sigma-Aldrich) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from sub-cultured isolates (loop of colonies) using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Changes in the ADP/ATP ratio were measured using the ADP/ATP ratio assay kit purchased from Sigma-Aldrich which is based on a luciferin - luciferase assay ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was crosslinked using UV light and hybridized with a DIG labelled probe (PCR DIG probe synthesis kit, Sigma). For detection of LbuCas13a the membrane was stripped and probed with DIG labelled Cas13a specific probe and signal detected on a Licor Odyssey imaging system (LI-COR Bioscience ...
-
bioRxiv - Molecular Biology 2021Quote: Boyden chamber transwell migration assays were set-up according to the cell migration assay kit manufacturer’s instructions (Sigma #ECM507), with RAW264.7 macrophages seeded in the upper chamber (30,000 per chamber ...
-
bioRxiv - Microbiology 2021Quote: ... YFP-dsRNA was labeled using the fluorescein RNA Labeling Mix Kit following the manufacturer’s instructions (Sigma, St. Louis, MO). For confocal microscopy examination of fluorescent dsRNA uptake by fungal mycelium ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids encoding the selected peptides were isolated in 96-well format using the Montage Plasmid MiniprepHTS Kit (MilliPore, LSKP09604) on a MultiscreenHTS Vacuum Manifold (MilliPore ...
-
bioRxiv - Neuroscience 2021Quote: ... Cytokines/chemokines were then quantified by multiplex immunoassay using a high sensitivity mouse multiplex magnetic bead kit (Millipore Sigma) and performed according to the manufacturer’s recommendations (MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel-Immunology Multiplex Assay ...
-
bioRxiv - Biochemistry 2020Quote: ... fixed and stained for β-galactosidase activity at pH = 6 using Senescence Cells Histochemical Staining Kit (Sigma, Cat#CS0030). For rescue assays ...
-
bioRxiv - Cell Biology 2021Quote: VCAM-1 in the media (1:100) from MCECs stimulated with MG was measured using commercial kits from Sigma, according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Free fatty acids were measured by a colorimetric assay using the Free fatty acid quantification Kit (Sigma-Aldrich, #MAK044) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: Apoptotic cells in the lung were detected by immunohistochemistry using the ApopTag in situ apoptosis detection kit (EMD Millipore) following the manufacturer’s directions ...
-
bioRxiv - Biochemistry 2021Quote: ... Pluripotency status of control and ABCF1-knockdown cells were analyzed using an alkaline phosphatase (AP) detection kit (EMD Millipore), or by RT-qPCR analysis of mRNAs purified using TRIzol reagent (Life Technologies).
-
bioRxiv - Immunology 2021Quote: ... and growth factors were quantified in plasma using a 23-plex MAP NHP immunoassay kit (PCYTMG-40K-PX30, Millipore) following the manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The PLA was conducted according to the manufacturer’s instructions using the Duolink In Situ Red Starter Kit Mouse/Rabbit (Cat. No. DUO92101, SIGMA). After blocking for 30 min at 37°C ...