Labshake search
Citations for Millipore Sigma :
4201 - 4250 of 5563 citations for Rat Malonyl Coenzyme A Decarboxylase MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Nuclear and cytoplasmic extracts were prepared from differentiated THP-1 cells using Nuclei EZ Prep kit (Sigma-NUC101) both from un-stimulated and MprA stimulated cells ...
-
bioRxiv - Molecular Biology 2021Quote: Detection of apoptotic cells was determined by using ApopTag® Fluorescein In Situ Apoptosis Detection Kit (Sigma Aldrich). Paraffin sections were deparaffinized and hydrated as described and then treated with proteinase K (20 μg/mL ...
-
bioRxiv - Physiology 2020Quote: ... Subcellular fractions were extracted using differential lysis and solubilization with a commercial Millipore Compartmental Protein Extraction Kit (Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Arginase activity was analyzed on Plasma using the Arginase Activity Assay Kit (MAK112, Sigma-Aldrich, St. Louis, MO) following the manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: Cells were crosslinked with 1% formaldehyde for 10min before chromatin fragmentation with EZ-enzyme kit 17-375 (Millipore) following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitation of m6A-modified transcripts was carried out with Magna MeRIP™ m6A Kit (Merck-Millipore, 17-10499) following the manual ...
-
bioRxiv - Microbiology 2022Quote: ... Chitinase activity of cell free supernatants was measured using a commercially available fluorometric chitinase assay kit (Sigma-Aldrich) following the protocol ...
-
bioRxiv - Genetics 2022Quote: The amplification of the whole mtDNA was performed with the Expand™ Long Range dNTPack kit (Sigma Aldrich) according to Fendt et al ...
-
bioRxiv - Immunology 2022Quote: ... The reaction was revealed with 3,3′-diaminobenzidine Substrate Kit for Peroxidase and fast blue substrate (both Sigma-Aldrich, St ...
-
bioRxiv - Molecular Biology 2022Quote: Cell growth was monitored by cell counting and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay using MTT cell growth assay kit (#CT02, Millipore). FL or ΔN-Drosha cells (1×105 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lactate and pyruvate were measured in the protein-depleted flow-through using assay kits (MAK064-1KT, Sigma-Aldrich) and (ab65342 ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant and standards containing bovine serum albumin (BSA) were analyzed using a BCA protein assay kit (Sigma).
-
bioRxiv - Bioengineering 2022Quote: ... we cultured T-SLICE in the presence of 100 μM of the EF5 Hypoxia Detection Kit (Sigma-Aldrich). Cell culture media was supplemented with 100 μM EF5 incorporated into the media for 6 ...
-
bioRxiv - Bioengineering 2022Quote: Measurements of L- and D-lactic acid were using standard D- and L-lactate assay kits (Sigma-Aldrich) according to manufacturer’s instruction after optimization (Supplementary Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... The ChIP assay was performed according to the manufacturer’s instructions (EZ-Magna ChIPTM A/G kit, EMD Millipore). In brief ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA was extracted using Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, United States) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: DNA (0.5-1µg) was bisulfite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN) ...
-
bioRxiv - Genomics 2022Quote: ... Single nuclei from fetal brain were isolated using Pure Prep Nuclei Isolation kit (Sigma, St. Louis, MO, USA) as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Full length CDS of DvCHR was labelled with the DIG RNA Labeling Kit (Sigma-Aldrich, St. Louis, USA). The probe was hybridized to the membrane at 50 °C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from freshly ground tissue using the Spectrum™ Plant Total RNA Kit (Sigma Aldrich). RNA samples were used to generate sequence libraries using a library prep kit from New England Biolabs (NEB #E7530) ...
-
bioRxiv - Microbiology 2022Quote: Serum cytokines were determined using a custom premixed Milliplex Map porcine cytokine/chemokine magnetic beads kit (Millipore, USA) for 13 cytokines i.e ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2018a). An Ellman assay (Ellman et al. 1961) was performed using an Acetylcholinesterase activity assay kit (Sigma-Aldrich). Absorbance was read at 412 nm every minute for 10 minutes using a VersaMax (Molecular Devices ...
-
bioRxiv - Neuroscience 2022Quote: The relative intracellular malondialdehyde (MDA) concentration was assessed using a Lipid Peroxidation (MDA) Assay Kit from Sigma-Aldrich. Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... MSK-QRESS-KIT] and 1μL was injected into a ZIC-pHILIC 150 × 2.1mm (5μm particle size) column (EMD Millipore) operated on a Vanquish™ Flex UHPLC Systems (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Actin RNA and viral RNA were measured using the KAPA SYBR fast universal qPCR kit (Sigma-Aldrich, US) on the QuantStudio real-time PCR system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: Digoxygenin (DIG)-labeled probes were produced with the SuperScriptTM III One-Step RT-PCR kit (Sigma 12574-026) using specific primers for the Bgl-FaNaC transcript (Forward ...
-
bioRxiv - Physiology 2023Quote: ... 8µl of plasma was used to determine NEFAs concentration using the Free Fatty Acid Quantitation Kit (Sigma: MAK044) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA from 50 mg FW sporophytes was isolated with the Spectrum Plant Total RNA Kit (Sigma-Aldrich) applying protocol B ...
-
bioRxiv - Cancer Biology 2024Quote: The proximity ligation assay was performed using the Duolink In Situ Orange starter kit mouse/rabbit (Millipore-Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: The proximity ligation assay was performed using the Duolink In Situ Orange starter kit mouse/rabbit (Millipore-Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Snap frozen lungs were homogenized and nuclear extracts were obtained using the CelLyticTM NuCLEARTM Extraction Kit (Millipore-Sigma). Protein concentrations were determined by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and fruits of three replicate were isolated by using RaFlex Total RNA isolation Kit (Merck Millipore, Massachusetts, USA) by following the standard protocol defined by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... or MG132 using a MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-based in vitro toxicology kit (TOX1-1KT, Sigma). 10 µl MTT solution was applied to cells at the end point of the experiment and incubated for 4 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... Congo red staining was performed using a Congo red amyloid stain kit procedure (Sigma Aldrich, St Louis, MO). Pathological tau was evidenced with CP13 (1/50 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were incubated with anti-mouse minus and anti-rabbit plus PLA probes (PLA kit from Sigma) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blue Dextran from the Gel Filtration Molecular Weight Markers Kit for Molecular Weights 29,000–700,000 Da (Sigma Aldrich) was used as a void volume marker and the six proteins (Albumin ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl of Alexa Fluor 488 click reaction cocktail (Click-iT Plus EdU Flow Cytometry Kit; Sigma C10633) was added for 30 minutes in the dark at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... the invaded cells were fixed and stained with a Harleco Hemacolor staining kit (EMD Millipore, Oakville, ON, Canada). The non-invaded cells remaining at the top of the membrane were removed with a cotton swab ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Protein quantification for each sample was conducted by BCA Assay in accordance with kit instructions (Millipore Sigma 71285M).
-
bioRxiv - Biochemistry 2024Quote: ... The cell lines were tested for mycoplasma contamination using the LookOut® Mycoplasma PCR Detection Kit (Sigma Millipore) and were found to be negative for mycoplasma.
-
bioRxiv - Biochemistry 2024Quote: ... The cell lines were tested for mycoplasma contamination using the LookOut® Mycoplasma PCR Detection Kit (Sigma Millipore) and were found to be negative for mycoplasma.
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from cryopreserved patient tissue samples using GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Each cell line was tested monthly for mycoplasma using the Lookout Mycoplasma PCR detection kit (Sigma-Aldrich, # MP0035) and confirmed mycoplasma free ...
-
bioRxiv - Neuroscience 2024Quote: ... Upper layer was used for TG measurement using Serum Triglyceride Determination kit (TR0100, Sigma Aldrich, Saint Louis, USA). Serum leptin was measured with Mouse Leptin ELISA KIT #90030 ...
-
bioRxiv - Neuroscience 2024Quote: Cell viability was measured using the cell counting kit-8 (CCK-8) (Sigma-Aldrich, St. Louis, MO, USA) as previously described 104 ...
-
bioRxiv - Physiology 2024Quote: ... Citrate synthase activity in C2C12 myotubes was measured with a Citrate Synthase Activity Assay Kit (MAK193, Sigma-Aldrich) and following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of the supernatant was then mixed with 4 µL of glucose assay kit (Sigma GAHK20-1KT) and incubated for 1 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of each sample was then mixed with 4 µL of glucose assay kit (Sigma GAHK20-1KT) and incubated for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... we extracted total RNA with the GenElute™ Mammalian Total RNA Miniprep Kit (#RTN350-1KT, Sigma Aldrich, USA). For both RNA-Seq and WGBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse genotypes were determined by PCR using genomic DNA extracted using the REDExtract-N-Amp kit (Sigma XNAT) according to the manufacturer’s protocol ...