Labshake search
Citations for Millipore Sigma :
4101 - 4150 of 10000+ citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... IL-17 and CCL17 were determined with ELISA assays according to the manufacturer’s protocols (Sigma, St. Louis, MO, USA).
-
bioRxiv - Physiology 2021Quote: ... and adipokine levels were measured via ELISA (adiponectin: Millipore EZ-MADPK, leptin: Millipore EZML-82K, resistin: R&D MRSN00). For HFD experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... The effect of DMAPT on cell proliferation was measured using the Bromodeoxyuridine (BrDU) incorporation-ELISA (Millipore, Cat. No. 2752) as per the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... or IgG2a-HRP conjugated (Southern Biotechnology Associates) and TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...
-
bioRxiv - Cell Biology 2020Quote: ... R-spondin 3 and Noggin were selected during the 3 first days post seeding by adding 0.5 mg/mL G418 (Sigma-Aldrich) and 0.5 mg/mL Hygromycin B (InvivoGen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Osteogenic differentiation was performed in osteogenic medium (Cyagen, GUXMX-90021) for 3 weeks (medium was changed every 3 days) and quantified by alizarin red staining (Sigma) and qPCR ...
-
bioRxiv - Cell Biology 2019Quote: Cells were washed with PBS then incubated with CSK buffer 3 times for 3 minutes and once for half minute [10 mM Hepes pH 7.0 (Sigma-Aldrich), 100 mM sucrose (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2019Quote: ... Y187 strains were grown on SD/-Trp-Leu medium and transferred to SD/-Trp-Leu-His medium with 10 mM 3-aminotriazole (3-AT, Sigma) in gradient dilutions (1:10 ...
-
bioRxiv - Genetics 2019Quote: ... Aliquots of 1-3 x 109 cells in 150 ml YPD/synthetic medium were fixed in 3% formaldehyde (Sigma, F8775) for 20 min at room temperature and quenched with 25 ml glycine 2.5 M for 20 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain slices containing the ZI slices were first washed (3×3 mins) with 1X Tris-buffered saline (TBS) (Sigma Aldrich) with 0.1% Tween-20 (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... crosslinked to the membrane by chemical treatment at 60°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Sigma) for 1 h 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was transferred to Hybond Nx nylon membranes (Amersham) and crosslinked using EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Sigma) (Pall & Hamilton 2008) ...
-
bioRxiv - Neuroscience 2020Quote: Midbrain or DMS-containing slices were washed (3×3 mins) with 1X Tris-buffered saline (TBS) with 0.1% Tween-20 (Sigma Aldrich), permeabilized (20mins ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then washed with PBS and treated with DAB solution (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 0.06% H2O2) for visualization ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate, Sigma+0.06% H2O2) for color development and visualization ...
-
bioRxiv - Bioengineering 2020Quote: ... and immersed in modified Karnovsky’s fixative (2% w/v glutaraldehyde and 3% w/v PFA in 0.1 M sodium cacodylate buffer containing 5mM CaCl2 and 3% sucrose, all from Sigma-Aldrich) for 1 h at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.5 mmol AuCOOH NPs were added to 200 mL ethanol (80% v/v) containing 1.44 g 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Sigma-Aldrich) and 0.65 g N-hydroxysulfosuccinimide (NHS ...
-
bioRxiv - Neuroscience 2021Quote: ... TAK242 in which mice were subjected to TBI and treated with the TLR4 inhibitor TAK242 diluted in saline containing 3% DMSO (3 mg·kg−1; Sigma-Aldrich). TAK242 or saline were i.p ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Biochemistry 2019Quote: ... Starter cultures were initiated with 1 transformed colony inoculated in a culture tube containing 3 mL LB and 0.1 mg/mL ampicillin (3 μL of 100 mg/mL stock) (Sigma Aldrich) and incubated for ca ...
-
bioRxiv - Cell Biology 2022Quote: ... glass coverslips were etched homogenously with a 0.1 M NaOH solution for 3 min and then treated with 3-(trimethoxysilyl)propyl methacrylate (cat. no. 440159, Sigma-Aldrich) to introduce amine groups to cross-link with the polyacrylamide hydrogel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fixed embryos were washed with 3%HCl/70%EtOH solution for 3 times and stained in 1% Victoria blue B (Sigma) dissolved in 3%HCl/70%EtOH overnight ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: ... Skin was minced into small pieces (about 2-3 mm × 2-3 mm) and digested by incubation with 1 mg/mL collagenase V (Sigma) in PBS for one hour with shaking (250 rpm) ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2024Quote: ... The amine reactive second-generation (AR2G) biosensors were processed with 1-ehtyl-3-(3-dimethylaminopropy) carbodiimide hydrochloride (EDC, E1769, Sigma) and sulfo-N-hydroxysulfosuccinimide (s-NHS ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mm ID × 150 mm, 3-μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate / water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Dried extracts were phase-separated using -20°C LCMS-grade chloroform/methanol/water (1:3:3, v/v) (Sigma Aldrich).
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Neuroscience 2023Quote: ... were placed in the middle of a 2% agar plate containing a container with 10 µl n-amylacetate (AM, diluted 1:50 in mineral oil; SAFC) or 3-Octanol (3-Oct, Sigma) on one side and a blank on the other side ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Cancer Biology 2024Quote: The following drugs targeting the p53 pathway were used for treatment: RO-5963 (MDM2/MDMX dual inhibitor, #444153, Sigma=:Aldrich, St. Louis, MO, USA) and PRIMA-1MET (mut-p53 reactivator ...