Labshake search
Citations for Millipore Sigma :
351 - 400 of 3415 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Human AB serum (Millipore) was diluted 1/10 to a final volume of 200 mL in ice-cold PBS + 0.1% Tween 20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human E2F1 shRNA (Sigma): TAACTGCACTTTCGGCCCTTT ...
-
bioRxiv - Cell Biology 2024Quote: ... recombinant human (AG968, Sigma). The information for all other reagents is indicated in corresponding sections.
-
bioRxiv - Biochemistry 2023Quote: ... recombinant insulin human (≥ 98%), somatostatin-14 (≥ 97%, human HPLC grade), and urocortin-3 (≥ 97%, human HPLC grade) were all purchased from Sigma-Aldrich. Taxonomy will only be indicated for insulin ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with DNA 24 h after siRNA treatment using Genejuice (Merck Millipore), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with negative control or with predesigned siRNAs (Sigma-Aldrich or Ribobio) targeting the indicated genes (Table S2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 µM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Biochemistry 2020Quote: ... Off-target effects were controlled using a scrambled siRNA control sequence (SIC001, Sigma-Aldrich) at 10 nM ...
-
bioRxiv - Biochemistry 2020Quote: ... Mission siRNA and universal negative control #1 was from Sigma-Aldrich (St. Louis, MO). Mitomycin C (MMC ...
-
bioRxiv - Microbiology 2021Quote: ... The scramble siRNA controls used were universal siCTRL1 (SIC001) and siCTRL2 (SIC002) (Sigma-Aldrich) and the sequences of the siRNAs targeting DDX42 were siDDX42-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... siTIP60-2 is a commercially available siRNA purchased from Sigma Aldrich (Cat. No. SASI_Hs01_00073301).
-
bioRxiv - Cancer Biology 2021Quote: HPDE and SUIT-2 cells were transfected with siRNAs by using oligofectamine (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... endonuclease-treated siRNA pool (esiRNA) generated against VTN and p65 (all from Sigma-Aldrich) were used while for experimental control ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 µM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... NEDD1 and POC5 was performed by transfecting cells with the following siRNA oligonucleotides (Sigma) CEP192 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with 20 nmol siRNA (mouse Lap2: 5’-GAUGUGACAGAGCUCUCUA predesigned from Sigma; mouse Lap2α ...
-
bioRxiv - Cell Biology 2022Quote: ... while for experimental control MISSION® siRNA Universal Negative Control (both from Sigma Aldrich) was used at a concentration of 30 nm each ...
-
bioRxiv - Cell Biology 2022Quote: ... The siRNA NPs were purified by an ultrafiltration device (EMD Millipore, MWCO 100 kDa) to remove the organic solvent and free excess compounds via centrifugation at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution of siRNA (20 pMol) in 2.5 µL nuclease-free water (Sigma, USA) was mixed with 2.5 µL of peptide’s solutions in nuclease-free water ...
-
bioRxiv - Cancer Biology 2023Quote: ... as a negative control we used siRNA Universal Negative Control #1 (SIC001, Sigma-Aldrich). Cells were plated onto 6-well plate for western blot or on glass coverslips for confocal microscopy ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following siRNAs were used in this study: si-mmu-Sox4-1 (Sigma #SASI_Mm01_00114970), si-mmu-Sox4-2 (Sigma # SASI_Mm01_00114972) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a validated scrambled control siRNA were obtained from Sigma-Aldrich (St. Louis, MO). Human siRNA smart pools for LRG1 (Cat# sc-97202) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Microbiology 2023Quote: ... The sequences of the siRNAs targeting MAT2A were 5’- CUGAUGCCAAAGUAGCUUG-3’ (Millipore Sigma, SASI_Hs01_00041621) and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with VAMP8 siRNA (Product no. NM_031827, #SASI_Rn01_00112721, Millipore Sigma, USA) at a final concentration of 10 nM using Lipofectamine RNAiMAX transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... from QIAGEN or costume siRNA against MdmX (siMdmX#1, sequence: 5’-AGAUUCAGCUGGUUAUUAA-3’) from Sigma-Aldrich. For Spry4 knockdown cells were transfected with a pool of 3 siRNAs against Spry4 (s37824 ...
-
bioRxiv - Biochemistry 2023Quote: ... CUL1 (Dharmacon siGENOME SMARTPool M-004086-01-0005) or Control siRNA (Millipore Sigma SIC001) were transfected using LipofectamineTM RNAiMAX Transfection Reagent (Invitrogen 13778075 ...
-
bioRxiv - Molecular Biology 2024Quote: The siRNAs used for gene knockdown experiments were chemically synthesized (Sigma-Aldrich, Shanghai GenePharma). The sequences of siRNAs are shown in Table S1.
-
bioRxiv - Cancer Biology 2024Quote: ... All siRNAs are treated at 10 nM concentration and are obtained from Sigma-Aldrich: human si-GLUL (SASI_Hs02_00307974) ...
-
bioRxiv - Cell Biology 2024Quote: ... The siRNA NPs were purified by an ultrafiltration device (EMD Millipore, MWCO 100 kDa) to remove the organic solvent and free excess compounds via centrifugation at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... human iPSC-derived cardiomyocytes were suspended in fibrinogen from human plasma (Sigma-Aldrich) at a concentration of 50x106 cells/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... human iPSC-derived cardiomyocytes were suspended in fibrinogen from human plasma (Sigma-Aldrich) at a concentration of 50x106 cells/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and retinal levels of human Pi and serum levels of human insulin were measured using human Pi and human insulin ELISA kits (EZHPI-15K and EZHI-14K, respectively; Millipore, Darmstadt, Germany) according to the manufacturer’s instructions and as described previously (Isiegas et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... the iBMECs were seeded in the vascular channel at a density of 16 x 106 cells/ml using iBMEC seeding medium (human serum-free endothelial cell medium supplemented with 5% human serum from platelet-poor human plasma (Sigma, Cat.# P2918) and allowed to attach to the membrane overnight (the bottom side of the chip was facing up during this period) ...
-
bioRxiv - Microbiology 2020Quote: ... Human serum-supplemented medium was made through addition of complete human serum (Sigma Aldrich) into CDM to a final concentration of 5% (v/v) ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with 10 % heat-inactivated human serum from human male AB plasma (Sigma-Aldrich), 2.5 μM zoledronic acid (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in an equal volume of human serum from human male AB plasma (Sigma) and incubated for 16 h at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and human chorionic gonadotropin (Sigma), 48 hours apart ...
-
bioRxiv - Biochemistry 2020Quote: ... human cathepsin S (Millipore Sigma), bovine spleen cathepsin C (Millipore Sigma) ...
-
bioRxiv - Biophysics 2022Quote: ... 20nM human insulin (Sigma-Aldrich), 2 μM rosiglitazone (Cayman) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% human serum (Sigma-Aldrich), 1x MEM Vitamins (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% human serum (Sigma-Aldrich) and 100 μg/ml primocin (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% human serum AB (Sigma), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2020Quote: ... or human plasma FN (Sigma) solutions ...
-
bioRxiv - Immunology 2021Quote: ... A human IgG (Sigma #I2511) or IgM (Sigma #I8260-1MG ...
-
bioRxiv - Bioengineering 2021Quote: ... Human serum albumin (Sigma, USA) was used as a control ...
-
bioRxiv - Bioengineering 2021Quote: ... human insulin (Sigma-Aldrich, I2643), single strand DNA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... hemoglobin (human, Millipore Sigma #G4386), gamma-globulin (human blood ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.02% human-EGF (Sigma, E5036), and 0.01% cholera toxin (Sigma ...