Labshake search
Citations for Millipore Sigma :
451 - 500 of 3415 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... A human IgG (Sigma #I2511) standard curve (ten three-fold serial dilutions starting at 20 µg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... 1% human insulin (Sigma-Aldrich), and penicillin (100 I.U./ml ...
-
bioRxiv - Immunology 2023Quote: ... 2% human serum (Sigma-Aldrich), 1% non-essential amino acids (ThermoFisher) ...
-
bioRxiv - Bioengineering 2024Quote: ... Human thrombin (Sigma, #T6884-100UN) was reconstituted in sterile 0.9% saline supplemented with human serum albumin (0.1% w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... thrombin (from human plasma, Sigma) and aprotinin (from bovine lung ...
-
bioRxiv - Immunology 2024Quote: ... 10% human serum (Sigma-Aldrich), 100 U/ml Penicillin (Cellgro Technologies LLC) ...
-
bioRxiv - Immunology 2024Quote: ... 5% human AB serum (Sigma), 500 IU/mL of IL-2 (Proleukin S ...
-
bioRxiv - Molecular Biology 2024Quote: Recombinant human PDE8A (Sigma SRP0273) was incubated with 100 ng FAK tyrosine kinase (Promega #V1971 ...
-
bioRxiv - Molecular Biology 2024Quote: Human serum (Sigma-Aldrich, H4522) was thawed on ice and centrifuged at 18,000 ×g for 10 min at 4 °C to remove lipids ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human β-endorphin (Sigma-Aldrich), teriparatide (MedChemExpress) ...
-
bioRxiv - Cell Biology 2024Quote: ... 850 nM human insulin (Sigma), 500 nM IBMX (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... 850 nM human insulin (Sigma), 500 nM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Biochemistry 2024Quote: ... human Leu-enK (Sigma-Aldrich) was recorded throughout the analysis to ensure mass accuracy.
-
bioRxiv - Biophysics 2024Quote: Lyophilized human methemoglobin (Sigma Aldrich) (metHb ...
-
bioRxiv - Biophysics 2024Quote: Lyophilized Human haemoglobin (Sigma-Aldrich) was resuspended in 50 mM HEPES pH 7.4 to a final concentration of 3mg/ml and centrifuged at 10,000 g for 10 min at 4°C ...
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... Cells were reverse transfected in quadruplicate in 384-well plates with 20nM of siRNA (Sigma) using RNAiMax as transfection reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... Mission siRNA universal negative control #1 was used for all negative controls (SIC001-1NMOL; Sigma). All siRNAs were used at a final concentration of 25 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... with siRNAs (SASI_Hs01_00180215 for Set8, SASI_Hs02_00348728 for Suv420h1, and Universal Negative Control #1, Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Mission siRNA universal negative control #1 was used for all negative controls (SIC001-1NMOL; Sigma). All siRNAs were used at a final concentration of 25 nM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and siRNA duplexes were synthesized by manufacturers (Nippon Gene Co., Ltd and Sigma-Aldrich, Merk). Lyophilized siRNA was resuspended in RNase free water to a final concentration of 6 μg/μl as stock solution ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were transfected using the N-TER Nanoparticle siRNA Transfection System (Sigma-Aldrich; Cat#N2913) at a final siRNA concentration of 50 nM with serum-free medium for 4 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the siRNAs targeting BRN2 and SOX2 were purchased from Sigma Aldrich (St. Louis, MO). The Trib2 promoter (−5.6kb ...
-
bioRxiv - Biochemistry 2022Quote: ... and scramble non-specific negative control siRNA were obtained from Sigma Aldrich (St. Louis, MO). Reagents for gene expression analysis ...
-
bioRxiv - Molecular Biology 2022Quote: ... Briefly BECs were transfected with siRNAs and stimulated with 10−7 M dexamethasone (Sigma Aldrich). 500 μg/ml cyclohexamide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... lysates were collected 72 hours post siRNA addition in RIPA lysis buffer (Sigma-Aldrich R0278) supplemented with cOmplete ULTRA protease inhibitor (Roche 5892791001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.25 µg/μl siATP1A3 (custom siRNA, sense: CUCGUUAACGAGCGCCUCA[dT][dT], antisense: UGAGGCGCUCGUUAACGAG[dT][dT], Sigma) or siCtl (SIC001 ...
-
bioRxiv - Neuroscience 2024Quote: ... MAFF and control siRNA using the GenEluteTM Single Cell RNA Purification Kit (#RNB300, Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used two different siRNAs targeting METTL3 CDS (CUGCAAGUAUGUUCACUAUGA[dT][dT], AGGAGCCAGCCAAGAAAUCAA[dT][dT], Sigma) at concentration 40 nM (20 nM each siRNA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Negative control siRNA that does not target any known coding sequence in mouse (Mission, Sigma) was included (50nM only ...
-
bioRxiv - Pathology 2020Quote: ... high-purity (>99%) human CRP obtained from human plasma (C4063; Sigma-Aldrich, Saint Louis, Missouri) was infused via the femoral vein after 45 minutes of ischemia with LAD ligation ...
-
bioRxiv - Biophysics 2020Quote: ... Human Serum from human male AB plasma and NaOH 1N Bioreagent were purchased from Sigma. ss M13mp18 ...
-
bioRxiv - Immunology 2023Quote: ... Human platelets were stimulated with 1 U ml−1 Thrombin from human plasma (Sigma-Aldrich) or left unstimulated for 30 min to assess the purity and activation of isolated cells ...
-
bioRxiv - Biochemistry 2024Quote: ... and human apo-transferrin (P02787) isolated from human plasma were purchased from Sigma Aldrich (E0518), Invitrogen (RP-43132) ...
-
bioRxiv - Biochemistry 2021Quote: Sequences for siRNAs used are provided in Supplemental Table 1 and were purchased commercially (Sigma-Aldrich). Oligonucleotides were annealed to form siRNA duplexes by heating to 95 °C in PBS and cooled at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: Gene knockdown was performed as described previously 43 with the following siRNAs purchased from Sigma-Aldrich:
-
bioRxiv - Molecular Biology 2022Quote: ... siRNA transfected HUVECs were seeded on fibronectin coated 5μm SMWP membrane filters (Merck Millipore Cat# SMWP02500) and inserted atop the silicon ring [see figure 7].
-
bioRxiv - Molecular Biology 2021Quote: A synthetic pool of siRNAs was used to target and knock down DHPS (Sigma-Aldrich, #EMU150671) or eIF5A (Santa Cruz ...
-
bioRxiv - Developmental Biology 2022Quote: ... GJA1 siRNA- or plasmid DNA-transfected RPE1 cells were cultured on fibronectin (Sigma Aldrich, MO, USA)-coated cover glasses ...
-
bioRxiv - Microbiology 2021Quote: The Keap1 target-specific siRNAs were designed according to the Keap1 sequence and synthesized by Sigma. The nonspecific siRNA was used as a negative control to confirm the specificity of the inhibition ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected with siRNA oligonucleotides from Sigma (600 nM NEK6 600 or 100 nM NEK7) using Dharmafect transfection reagent (Dharmacon ...
-
bioRxiv - Cell Biology 2023Quote: ... The siRNA sequence targeting luciferase (CGUACGCGGAAUACUUCGA) was used as a control and was obtained from Sigma. siRNA delivery was performed using Lipofectamine RNAiMAX ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were harvested by trypsinization after siRNA transfection and/or starvation and Trypan Blue (Sigma #T8154) staining was used to determine cell viability on an automated cell counter (BioRad) ...
-
bioRxiv - Neuroscience 2024Quote: ... siRNA electroporated OLs were differentiated for 3 days and treated with cycloheximide (CHX; 239763-M, Sigma) at 100 μg/mL for 4 hours to stop protein translation ...
-
bioRxiv - Cell Biology 2024Quote: ... The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’) (NC, Sigma, St. Louis, MO, USA). A total of 60 nM siRNAs was used for transfection using Lipofectamine-RNAi-MAX Reagent (13778 ...
-
bioRxiv - Cancer Biology 2024Quote: Cherry□pick libraries targeting the 96-selected helicase and nuclease genes were purchased from Sigma (siRNA) and Dharmacon (crRNA ...
-
Inhibition of Ribosome Biogenesis in vivo Causes p53-Dependent Death and p53-Independent DysfunctionbioRxiv - Cell Biology 2024Quote: ... Transient knockdown of NAT10 was carried out using two siRNAs against NAT10 (SASI_Hs01_00215377; siNAT10#1, and SASI_Hs02_00357064; siNAT10#2, Sigma). MISSION® siRNA Universal Negative Control (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: The following antibodies were used procollagen VII (rabbit anti–human [Abcam]; mouse anti-human [Sigma-Aldrich]), Sec31A (mouse anti–human ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5□µg/ml human insulin (Sigma), 100 U/ml penicillin and 100□μg/ml streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... human epidermal growth factor (hEGF; Sigma), recombinant human basic fibroblast growth factor (bFGF ...