Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 5 Cyano 2 3 bis 3 cyanophenyl 2H tetrazolium chloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... mglBΔCT-R (5’-CGTAAAGCTTTTACACCAGGCTCTCGAAGATCTTCGTGAGCTC-3’ synthesized by Sigma-Aldrich, India ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’, Sigma-Aldrich) were mixed with 54 μl of RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the siRNA duplex 5′-UUCUCCGAACGUGUCACGUdTdT-3′ (Sigma). The cells were further processed according to the experimental design and depletion was assessed by immunofluorescence ...
-
bioRxiv - Genetics 2024Quote: ... moxidectin (3 nM) (Millipore Sigma, Catalog # 113507-06-5), ricobendazole (25 μM ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 nM Rab14 siRNA (5′-CAACUACUCUUACAUCUUU-3′, Sigma-Aldrich) for 72 h using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2023Quote: ... scrambled (NT) shRNA (5’-GCGATAGCGCTAATAATTT-3’ SHC202; Sigma-Aldrich) or a shRNA specific for human SOX11 (100% identity to the equine SOX11 sequence ...
-
bioRxiv - Microbiology 2024Quote: ... a 5% solution of 3-Aminopropyltriethoxysilane (APTES, Sigma-Aldrich) in tetrahydrofuran (THF ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Biochemistry 2021Quote: ... Sod1 activity was visualized by staining the gel with SOD activity staining solution (2.43 mM nitro blue tetrazolium chloride, Sigma, 0.14M riboflavin-50-phosphate ...
-
bioRxiv - Microbiology 2021Quote: The activity of superoxide dismutase was determined using the oxidation of 4-Nitro blue tetrazolium chloride (NBT) (Sigma-Aldrich) method ...
-
bioRxiv - Microbiology 2023Quote: ... metabolically active biofilm cells were two-hours stained with 500 µL of 0.1% (w/v) TTC solution (2,3,5-triphenyl-tetrazolium chloride, Sigma-Aldrich, USA) in TSB (Tryptic Soy Broth ...
-
bioRxiv - Microbiology 2021Quote: ... sodium chloride (EMD Millipore, cat. SX0420-5), and potassium chloride (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM lithium chloride (Sigma, 62476) were added ...
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM lithium chloride (Sigma, 62476) were added ...
-
bioRxiv - Neuroscience 2020Quote: ... Sodium chloride (Sigma-Aldrich, 7647-14-5), Citric acid (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mM N-Ethyllidocaine chloride (QX314) (Sigma), pH 7.25.
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... and 125 μL 2% bis-acrylamide (bis-AA) (Sigma). The soft gel is made by thoroughly mixing 20 μL premix and 230 μL PBS ...
-
bioRxiv - Biophysics 2022Quote: ... with 5 % fluoro-surfactant 1H,1H,2H,2H-Perfluoro-1-octanol (CAS Nr 647-42-7, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 g/L U-[2H] glucose (Sigma-Aldrich, St ...
-
bioRxiv - Biophysics 2022Quote: ... SPR2 DNA encoding residues 649-864 was generated using the polymerase chain reaction method (primers: 5’-GGCAGGACCCATATGGGCAGGAGAGGGTGGGATAATAAAGC-3’ and 5’-GCCGAGCCTGAATTCTTACTTGTCGAACTGTTGGAGATCGATTTC-3’) and individually sub-cloned into pET28 (Millipore Sigma, Burlington, MA) using engineered NdeI and EcoRI restriction endonuclease sites ...
-
bioRxiv - Physiology 2024Quote: ... electrode tips were dipped in a solution of polyvinyl-chloride in tetrahydrofuran (10 mg in 3 mL; Sigma) to prevent ionophore displacement ...
-
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2024Quote: ... and 10−5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, C127; Sigma-Aldrich) were added to perfusion aCSF ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 methylcholanthrene (3-MC; Sigma-Aldrich), contained in DMEM with a final concentration of 0.1% of dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... 3-deazauridine (3-DU) (Sigma Aldrich) was used as a non-selective inhibitor of CTPS1 and CTPS2.
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), for 1 hour at 4°C on rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine, Sigma) or a combination of all three (BCKAs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich), and incubated 10 min on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich), and sonicated using a fine probe (0.5-sec pulse at an amplitude of 20% ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich) and sonicated using a fine probe (0.5-sec pulse at amplitude of 20% ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich). After sonication using a fine probe [(0.5-sec pulse at an amplitude of 20% ...
-
bioRxiv - Immunology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). Lysates were cleared by 10 min centrifugation at 15000xg and incubated with GFP-trap beads (Chromotek) ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting Vcan exon 2 or exon 3 (Sigma-Aldrich, target IDs MM0000080027 and MM0000080028 ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (Sigma phosphatase inhibitor 2 and 3), then sonicated using a Fisher sonicator at 12% amplitude for total of 20 seconds ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich). Cell lysates were cleared by centrifugation at 4 °C for 15 min at 13,000 rpm ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% 2-hydroxyethyl agarose (agarose, A4018; Sigma-Aldrich, Australia) was prepared as stock solution ...
-
bioRxiv - Immunology 2020Quote: ... and anti-phosphatase cocktails 2 and 3 (Sigma-Aldrich). Protein concentrations were quantitated with a BCA assay (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:100 Phosphatase Inhibitor Cocktails 2 and 3 (Sigma), 1:1000 Protease Inhibitor Cocktail (Sigma)) ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). For IPs ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3 (P5726 and P0044, Sigma), 0.1% NP-40 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and BDM (2, 3-butandion-monoxim, 10 mM, Sigma) were added to the perfusion solution ...