Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 5 Cyano 2 3 bis 3 cyanophenyl 2H tetrazolium chloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µL of 1% (w/v) TTC solution (2,3,5-triphenyl-tetrazolium chloride, Sigma-Aldrich, USA) in the medium was added to each well ...
-
bioRxiv - Neuroscience 2022Quote: ... or DMSO 0.1% as vehicle was evaluated using a MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) assay as described in (Sanz et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mg/mL nitroblue tetrazolium (Sigma Aldrich) and 0.1 mg/mL phenazine ethosulfate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... gallinamide A-bound cruzain was concentrated to 10 mg/mL and the activation buffer was exchanged to 2 mM Bis-Tris pH 5.8 using a centrifugal filter with molecular weight cut-off of 3 kDa (Millipore). For cruzain-gallinamide A analog complexes ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatment of mice were performed with a single intraperitoneal injection of either vehicle (corn-oil) or 3 mg/kg 1,4-bis-[2-(3,5,-dichloropyridyloxy)] benzene (TCPOBOP, T1443, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Genomics 2024Quote: ... a DNA and acrylamide mix (3% (v/v) acrylamide/bis solution (Sigma), 3% acrylamide solution (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Bioengineering 2021Quote: ... Devices were treated with 2% trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma) in Novec 7500 (3M ...
-
bioRxiv - Neuroscience 2020Quote: ... were performed in DJ-1-deficient cells with MTT (3-(4, 5-dimethylthiazol-2-yl)−2–5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in [24] ...
-
bioRxiv - Immunology 2020Quote: ... Mice were subjected to cutaneous immune challenge by applying 20 µl of 3-5% 4- Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in 1:2 acetone:olive oil ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine 5’-triphosphate (BzATP) (#B6396, Sigma-Aldrich), 20 µM MCC950 (#inh-mcc ...
-
bioRxiv - Bioengineering 2023Quote: The mice were anaesthetized with isoflurane (induction 5%, maintenance 2−3%; Sigma-Aldrich, USA) and secured in a stereotaxic instrument (RWD ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-ODibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Molecular Biology 2023Quote: Contents of superoxide radical were visualized using nitro blue tetrazolium chloride (NBT, Sigma-Aldrich [USA], 93862). Single leaves or whole rosette leaves from 4-week-old plants were incubated in NBT staining solution (25 mM HEPES/KOH ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Neuroscience 2020Quote: Cell viability was evaluated using the 3-(4,5-Dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide (MTT) assay (Sigma-Aldrich), which measures mitochondrial activity in living cells ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES) (Sigma, SML0601); an irreversible O-Carnitine palmitoyltransferase-1 (CPT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were blocked for 2h at RT (3% normal donkey serum [Sigma D9663], 0.1% triton-x), stained with 1’ ab for 12h at 4°C (EMD Millipore [ab144P ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... ammonium chloride (5 mM, Sigma); proteasomal degradation inhibitor ...
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...