Labshake search
Citations for Millipore Sigma :
3851 - 3900 of 3948 citations for IL 23R Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... untagged human α-synuclein (100 μg/well) —purified as previously described [17]—and 10 μM ThT in dPBS (Sigma-Aldrich, St. Louis, MO) were combined in a final volume of 95 μl of dPBS ...
-
bioRxiv - Microbiology 2021Quote: ... Sub-confluent T175 flasks of 293T cells (human embryonic kidney cell line) were transfected with the RBD-His tagged plasmid using X-tremeGENE 9 reagent (Millipore Sigma, Cat# 6365809001). Supernatant was collected 6 days post-transfection and filtered through 0.22 μm PES membrane filters (Nalgene) ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
bioRxiv - Immunology 2020Quote: Cytokine were measured in cell-free PBMC supernatant using MILLIPLEX-MAP human cytokine/chemokine magnetic bead panel (EMD Millipore Corporation, Billerica, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The pyrosequencing assay was validated using SssI-treated human genomic DNA as a 100% methylation control and human genomic DNA amplified by GenomePlex Complete Whole Genome Amplification kit (Sigma-Aldrich, WGA2-50RXN) as 0% methylation control ...
-
bioRxiv - Genomics 2022Quote: ... in a 12-well cell culture plate coated with Human recombinant laminin 511 (BioLamina, Cat. LN511-0202) and fixed in 1xPBS with 3.7% formaldehyde (Millipore Sigma, Cat. F8775-25ML) for 10 mins and then permeabilized in ice-cold 70% (vol./vol. ...
-
bioRxiv - Immunology 2022Quote: Cells were isolated from human blood using density gradient centrifugation agent Ficoll®-Paque Premium (17-5442-02, GE Healthcare, SIGMA, Darmstadt, Germany). Monocytes were plated at 3×105 cells per well in plastic 24 well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse mAb MEM48 which recognizes the human β2 integrin subunit (catalog #CBL158) and the mouse mAb 1965 against the human β1 integrin subunit (catalog #MAB1965) were from EMD Millipore (Burlington, MA). The rat PE-conjugated mAb against F4/80 (catalog #12-4801-82 ...
-
bioRxiv - Immunology 2024Quote: ... Total transferrin was kept constant at 1.2 mg/mL by adjusting human apotransferrin (unbound transferrin) concentrations (R&D systems, 3188-AT-001G/Sigma Aldrich, T1147) accordingly ...
-
bioRxiv - Cell Biology 2024Quote: ... was added to the cell pellet and stored at −20°C prior to being assayed for insulin using human insulin specific RIA (Millipore Cat# HI-14K).
-
bioRxiv - Immunology 2024Quote: ... Two different Mission lentivirus-based plasmids of shRNAs (clone numbers TRCN0000123050 and TRCN0000436778) against human ZBP1 and the shcontrol vector TRC2 pLKO.5-puro nonmammalian shRNA (SHC202) were obtained from Sigma-Aldrich (Burlington, MA). 293T cells were cotransfected with the shRNA and packaging plasmids psPAX2 and pMD2 using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Electroporated cells were cultured in erythroid differentiation medium (EDM) consisting of IMDM (GibcoTM, 12440061) supplemented with 330 µg/ml of Holo-Human Transferrin (Sigma-Aldrich, T0665-1G), 10 µg/ml of recombinant human insulin (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: IDUA enzyme expression was measured fluorometrically in a 96-well plate using a Human IDUA ELISA kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s sandwich assay protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)32,33 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... human islets were dispersed using dissociation solution (1X TrypLE™ Express solution - Thermo Fisher Scientific, with 40 µg/mL DNase I - Sigma-Aldrich) through gentle pipetting for 10 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Cells that received Interferon-β pre-treatment were stimulated for 18 hours with 100 units of recombinant human Interferon-β protein (Millipore, IF014) prior to infection.
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... The lentivirus enriched-medium was immediately used to transduce the human fibroblasts growing on a T25 flask in the presence of 8µg/ml polybrene (Sigma-Aldrich, San Luis, MO). Infected fibroblasts were maintained in culture until having enough cells for cell sorting ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: Concentrations of cytokines in supernatants of T cell cultures were assessed with the MILLIPLEX MAP Human Th17 magnetic bead panel kit (Merck Millipore, Burlington, MA, USA) and the Luminex® 200™ system according to the guidelines of the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cell lysate was generated as a Western blot positive control from the human endometrial epithelium Ishikawa cell line (Sigma-Aldrich, Madrid, Spain), as in a previous study (Vilella et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)36,37 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a subsequent 6-day differentiation step in serum-free medium containing 50 ng/ml human brain derived neurotrophic factor (BDNF) (Sigma-Aldrich, Cat# B3795). Cells were seeded at an initial density of 2 × 104 cells/cm2 in 24-well plate coated with Type I collagen (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... East Brunswick, NJ, USA), human recombinant Stem Cell Factor (100ng/mL, supernatant SCF producing cell line) and dexamethasone (1μM; Sigma, St. Louis, MO, USA).5 EBL cultures were kept at a density of 0.7-1.5 million/mL by dilution with fresh medium ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse (5 x 105 cells) and human (2 x 105 cells) keratinocytes were seeded onto 12 mm diameter inserts (Millipore, Catalog No. PIHP01250) and cultured in CnT-Prime medium ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CAR T cell product was cultivated in RPMI+10%FBS+1%PS at 37°C with 5% CO2 for experiments and cryopreserved as 10×106 cells/mL in 1 mL 90% heat-inactivated Human AB Serum (Sigma-Aldrich, Cat.#H4522) +10% DMSO in liquid nitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Both mouse and human brain sections were labeled for TH (mouse monoclonal, clone LNC1, 1:2000, Catalog No. MAB318, EMD Millipore, Burlington, MA) and VGLUT2 (rabbit polyclonal ...
-
bioRxiv - Bioengineering 2024Quote: ... human chorionic gonadotropin (hCG, for Jurkat: high 1000 IU/mL and low 200 IU/mL; PBMC: 500 IU/mL, Sigma catalog #CG5-1VL). Media controls were used to determine if media components alone affect protein secretion and expression ...
-
bioRxiv - Immunology 2021Quote: ... and Tumor necrosis factor-alpha (TNF-α)) were measured with a Milliplex MAP High-Sensitivity Human Cytokine Panel (HSCYTMAG-60SK-13, Millipore Corp., Billerica, MA) on a Luminex MagPix (Millipore Corp. ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were washed three times with saline at 200 × g for 10 min at RT to remove residual Percoll and suspended in RPMI 1640 medium (Cellgro, Manassas, VA) supplemented with 5% human serum (Sigma-Aldrich, St. Louis, MO), unless otherwise stated ...
-
bioRxiv - Genomics 2019Quote: ... we measured 41 different cytokines and chemokines using the Milliplex MAP Human Cytokine/Chemokine Magnetic Bead Panel (Millipore kit no. HCVD3-67CKHCYTOMAG-60K, Millipore Corp, St. Charles, MO). According to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and lymph node from BALB/cJ mice and humans were harvested and either fixed for 48 h at RT in 10% neutral buffered formalin (Sigma-Aldrich, St. Louis, MO) or zinc-fixation buffer (pH 6.5 - 7) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse and human brain slices of 20 μm thickness were subjected to antigen retrieval in 10 mM citrate (Sigma-Aldrich, St. Louis, MO, USA) + 0.5% Tween-20 (Merck ...
-
bioRxiv - Biophysics 2020Quote: ... Fibronectin coating was performed by covering the glass slides in a solution of DPBS with 10 μg/mL human fibronectin (EMD Millipore, Burlington, MA, USA) for at least 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: Labeling of septins on Western blots (WB) and/or on immunocytochemistry coverslip (ICC) was achieved with the following antibodies: rabbit polyclonals against human Sept2 (Sigma-Aldrich, Cat#HPA018481, WB), against human Sept9 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Human chorionic gonadotropin (hCG) as an effective Lh (Luteinizing hormone) mimicking hormone used in this study was purchased from Sigma-Aldrich (Oakville, ON, Canada). There is evidence that hCG transactivate Lhcgr (Luteinizing hormone/choriogonadotropin receptor ...
-
bioRxiv - Cancer Biology 2022Quote: ... Both these constructs were individually transfected in Ishikawa cells (human endometrial epithelial cells) using Xtreme Gene HP transfection reagent (Sigma Aldrich; Missouri, United States) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Cytokines in BAL fluid samples were measured (pg/ml) in singlicate by Luminex using a Millipore human cytokine multiplex kits (EMD Millipore Corporation, Billerica, MA) according to manufactures instructions ...
-
bioRxiv - Immunology 2021Quote: Cytokine and chemokine assays were performed by the Forsyth Multiplex Core (Cambridge, MA, USA) using the Human Cytokine/Chemokine Magnetic Bead Panel (Milliplex, Millipore Sigma, Burlington, MA, USA) and Bio-Plex®200 plate reader following manufacturers’ specifications ...
-
bioRxiv - Microbiology 2022Quote: ... African green monkey kidney Vero’76 and human lung adenocarcinoma Calu-3 cells were maintained in DMEM (Sigma-Aldrich, D5796; St. Louis, MO, USA) supplemented with 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP Non-human Primate Cytokine Panel in combination with a Luminex 200 (Millipore Corp., Billerica, MA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: HeLa cells were purchased from the Human Science Research Resources Bank and maintained in DMEM (Nacalai tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum (Sigma-Aldrich, St. Louis, MO). BVRA-KO HeLa cells (HeLa/BVRA KO ...
-
bioRxiv - Pathology 2019Quote: ... and TGF-β1 in the samples was measured using magnetic bead-based multiple immunoassays (MILLIPLEX® MAP kit, Human High Sensitivity T Cell Magnetic Bead Panel: EMD Millipore Corporation, Germany). Each assay included two calibration curves for each of the proteins to be measured (calibration ranges ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 cells (a human lung epithelial cell line; ATCC HTB-55) were maintained in Minimum essential medium Eagle (Sigma-Aldrich, cat# M4655-500ML) containing 10% FCS and 1% PS ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-amyloid precursor protein (APP; mouse anti-human monoclonal antibody clone 22c11, dilution 1:10, epitope retrieval time 10 min, MAB348; EMD Millipore, Burlington, MA, USA); anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Microbiology 2021Quote: ... sBHI media controls or Porphyromonas cell-free supernatants (240 µg of total protein) were incubated with 120 µg of human fibrinogen (Sigma-Aldrich, St. Louis, MO). Reaction mixtures were incubated at 37°C under anaerobic conditions or in an atmosphere of 5% CO2 for cell suspension or cell-free supernatants ...
-
bioRxiv - Immunology 2021Quote: TEER was measured in the human airway epithelium inserts to determine the integrity of tight junctions with a Millicell ERS-2 volt-ohmmeter (Millipore Sigma, Burlington, MA, USA). Briefly ...
-
bioRxiv - Microbiology 2021Quote: Calu-3 cells (a human lung epithelial cell line; ATCC HTB-55) were maintained in Minimum essential medium Eagle (Sigma-Aldrich, Cat# M4655-500ML) containing 10% FCS and 1% PS.